ID: 1099359414

View in Genome Browser
Species Human (GRCh38)
Location 12:81681290-81681312
Sequence CAAGGTGTGAAAAACCTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099359414 Original CRISPR CAAGGTGTGAAAAACCTAAG TGG Intronic
900883332 1:5397971-5397993 CAAGCTGGGAACAACCTAAGAGG + Intergenic
902890015 1:19436139-19436161 CATGGTCTGAAAATACTAAGTGG + Intronic
903948210 1:26977662-26977684 CAAAGTCTGAAGAAGCTAAGAGG - Intergenic
904681373 1:32231766-32231788 CAAGGTGTAAAGGTCCTAAGGGG + Intergenic
905146716 1:35892941-35892963 CAAGGTGGCTAGAACCTAAGGGG + Intronic
905617444 1:39410884-39410906 CAAGATTTTAAAAACTTAAGTGG + Exonic
907108057 1:51901867-51901889 CAAGGTGGAAAAAACAGAAGGGG - Intergenic
910615144 1:89189424-89189446 CAAGGAGTGAGAAACCTTATGGG - Intronic
912484143 1:110011169-110011191 CAAGGATAGAAAAACCTCAGTGG - Intronic
915122201 1:153636322-153636344 CAAGGTGGGAAAATCCTTTGAGG + Intronic
917521265 1:175750141-175750163 CCAGGTGAGAAACACCTAAATGG + Intergenic
918859698 1:189807189-189807211 CAAGGTGGAATCAACCTAAGTGG - Intergenic
924808638 1:247381868-247381890 CAAGGAGAGAAAAACATAAAGGG + Intergenic
924851828 1:247838768-247838790 CAAGATCTGAAAACCCTATGAGG + Intergenic
1065033160 10:21609157-21609179 CAAGGTGTGGCAATCCTAGGAGG - Intronic
1065734102 10:28735830-28735852 CAAGTTCTGAAAAACCTGACAGG + Intergenic
1066781608 10:38954253-38954275 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1068625576 10:59243046-59243068 CAAGCTGAGAAAACCCTAAATGG + Intronic
1069410286 10:68146427-68146449 TAATGTGTTACAAACCTAAGGGG + Intronic
1070983825 10:80671269-80671291 CAAGGTGTGAAAAAAGTAAGTGG - Intergenic
1072110586 10:92316313-92316335 TCAGTTGTGAAAAACTTAAGAGG + Intronic
1074740153 10:116478649-116478671 CAAGGTTTGAAAAGACTAATGGG + Intergenic
1075047707 10:119159326-119159348 CAAGGTGAGAAAAGCCTCACAGG + Intronic
1075269684 10:121037903-121037925 CATGGTCTGAAAATACTAAGTGG - Intergenic
1076150900 10:128161298-128161320 CCAGCTGTGCAAACCCTAAGAGG - Intergenic
1078089554 11:8256299-8256321 CAAAGGGTGAAACACCTAACTGG - Intronic
1081447464 11:43144653-43144675 CAAGGTGTCTATAACCTAAGGGG + Intergenic
1084583398 11:70038777-70038799 CAAGGTAGGAAAAACCTCAGAGG + Intergenic
1089077709 11:115751583-115751605 CTAGGTGTGAGAATCCGAAGTGG - Intergenic
1091483119 12:855207-855229 CAAGCTGGGAAAAACTTAGGTGG + Intronic
1092966479 12:13648493-13648515 GCAGGTGTGAAAAGCTTAAGGGG + Intronic
1095613691 12:44163256-44163278 GAAGGTCTGAAAAGCCTCAGTGG - Intronic
1099359414 12:81681290-81681312 CAAGGTGTGAAAAACCTAAGTGG + Intronic
1100822362 12:98443454-98443476 CAAGGTGTCAGCAAACTAAGCGG + Intergenic
1102303902 12:111790704-111790726 CAATGTGGAAAAAAGCTAAGAGG - Intronic
1106861082 13:33909495-33909517 CAAGGAGTGAGAAAAGTAAGAGG - Intronic
1109427223 13:62180748-62180770 CAAGGGCTGAAAAACCTATTGGG + Intergenic
1110130829 13:72007760-72007782 GAAGATGTGAAAAAACTAAGTGG + Intergenic
1110533325 13:76622400-76622422 AAATGTGTGCAAAACCTCAGTGG + Intergenic
1111436395 13:88215248-88215270 CAAAGTGTGGCAAGCCTAAGAGG - Intergenic
1117516494 14:56507198-56507220 CATGGTGTGAACAACCTGTGGGG - Intronic
1117782890 14:59253040-59253062 CAAGGTGGGAGAAACCCAGGGGG - Intronic
1119973546 14:79000020-79000042 CAGGGTGTGAAAAAAATCAGGGG - Intronic
1121057471 14:90871118-90871140 CAATGTGAGGAAAACCTAAAGGG - Exonic
1202938987 14_KI270725v1_random:124686-124708 AAAGATTTAAAAAACCTAAGTGG + Intergenic
1125104250 15:35952254-35952276 CAATGTATGCTAAACCTAAGTGG - Intergenic
1127623960 15:60762031-60762053 CCAGGTGTCTAAAACATAAGGGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128755414 15:70180491-70180513 TAGGGTGTGAAAAAGCAAAGGGG - Intergenic
1129611007 15:77057019-77057041 CAAGGTATTAAAGACCTAAAGGG + Intronic
1129779203 15:78258904-78258926 CAAGGTGTGAAGAACCAGAAAGG - Intergenic
1130001102 15:80047606-80047628 CATGGAGTGAAAAACCTGACTGG + Intergenic
1130760906 15:86818654-86818676 GAAGGTGTGAATGACCAAAGTGG + Intronic
1131619144 15:94048663-94048685 CAAAGTGTGAATAGCCTAGGAGG + Intergenic
1136868803 16:33782642-33782664 AAAGATTTAAAAAACCTAAGTGG - Intergenic
1137085610 16:36118283-36118305 AAAGATTTAAAAAACCTAAGTGG + Intergenic
1137768236 16:50994308-50994330 CAACATATGATAAACCTAAGTGG + Intergenic
1140042280 16:71416054-71416076 CAGGGAGTGAACAATCTAAGAGG - Intergenic
1140852381 16:78947262-78947284 CAGGGAGTTAAAAATCTAAGTGG - Intronic
1203103373 16_KI270728v1_random:1333426-1333448 AAAGATTTAAAAAACCTAAGTGG + Intergenic
1144761874 17:17711612-17711634 CAAGGTGAGGCAAACCTTAGAGG + Intronic
1145324575 17:21792394-21792416 AAAGATTTAAAAAACCTAAGCGG + Intergenic
1145326029 17:21826416-21826438 AAAGATTTAAAAAACCTAAGTGG - Intergenic
1145710857 17:26974690-26974712 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1146968848 17:37055897-37055919 CAAGGCCTGGAAAACCTAAAAGG - Intronic
1151127457 17:71860374-71860396 CAAGGTGTAAAATATCTAAGTGG + Intergenic
1152247094 17:79190627-79190649 CAGGGTGATAAAAACCTAACTGG - Intronic
1203182279 17_KI270729v1_random:71554-71576 AAAGATTTAAAAAACCTAAGTGG - Intergenic
1203190227 17_KI270729v1_random:177048-177070 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1156266391 18:35491820-35491842 CAAGATATGAACACCCTAAGAGG + Intronic
1156586698 18:38438866-38438888 CAAGGTATGAAAAACATGAATGG - Intergenic
1156746841 18:40402688-40402710 CAAGGTGCGAAAAAGATTAGTGG - Intergenic
1157737185 18:50060358-50060380 GAAGGTGAGAAAAAATTAAGAGG - Intronic
1158351503 18:56568903-56568925 CCAAGTCTGAAAAACCTATGTGG - Intergenic
1165504378 19:36215564-36215586 GAAGGGGTGGAAAAGCTAAGTGG + Intronic
925883505 2:8372698-8372720 CAAGTTGTGACAAAACTCAGAGG + Intergenic
927721718 2:25387473-25387495 ACAGGTGTGGAACACCTAAGGGG + Intronic
929537921 2:42795730-42795752 CAAGGTGAAAAGAAACTAAGAGG - Intergenic
930698533 2:54435916-54435938 CAAGGTGAGAGAAAATTAAGTGG + Intergenic
931082806 2:58794559-58794581 CAGGGTGTGAAAAAGCTGAGGGG - Intergenic
931832107 2:66063687-66063709 CAAGTTGGGAAAAATCTAAGAGG - Intergenic
934147464 2:89109473-89109495 GAAGGTGAAAAAAAGCTAAGTGG - Intergenic
934221807 2:90091119-90091141 GAAGGTGAAAAAAAGCTAAGTGG + Intergenic
934252839 2:90376424-90376446 AAAGATTTAAAAAACCTAAGTGG + Intergenic
934256602 2:91426523-91426545 AAAGATTTAAAAAACCTAAGCGG - Intergenic
934692522 2:96372482-96372504 CATGGTCTGAAAATACTAAGTGG + Intronic
936919743 2:117675779-117675801 CAAGCTGAGACAAACCTGAGTGG - Intergenic
936964086 2:118109769-118109791 GAAGGTGTGAAAATCCTAAGAGG + Exonic
938517298 2:132025737-132025759 AAAGATTTAAAAAACCTAAGCGG + Intergenic
938719321 2:134051948-134051970 CAAGGTGGGAAACACCCATGTGG - Intergenic
938972806 2:136447884-136447906 CAAGGAGTGAGAAATCTAACCGG + Intergenic
940658152 2:156513904-156513926 CAAGGGGTTATAAACCTAGGGGG + Intronic
940977869 2:159966602-159966624 GAATGTGTGAAAAATCCAAGTGG + Intronic
941236836 2:162985645-162985667 AAAGGTGTGAAAAACAGAATAGG + Intergenic
942827422 2:180195722-180195744 CAAAGTTTCAAAAAGCTAAGAGG - Intergenic
944434633 2:199674092-199674114 TCAGGTATGAAAACCCTAAGAGG + Intergenic
947731025 2:232431750-232431772 CATGCTGTGAAAATCCCAAGTGG + Intergenic
1170478345 20:16739531-16739553 CAAGAGGAGAAAAACCTCAGTGG - Intronic
1172588509 20:36101574-36101596 CAATTTGTGAAACACCTAAAAGG + Intronic
1174556378 20:51398324-51398346 CAAAGTGTGCAAAACCAAAAAGG + Intronic
1176584267 21:8562843-8562865 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1178032877 21:28547938-28547960 CAAGCTGTGAGAAACCCAAGTGG + Intergenic
1178683042 21:34689237-34689259 GGAGGTGTGGAAAACCAAAGGGG - Intronic
1180035163 21:45244344-45244366 CAAGGTGGGAAAAATAGAAGAGG - Intergenic
1180267078 22:10539747-10539769 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1203326176 22_KI270738v1_random:21904-21926 AAAGATTTAAAAAACCTAAGCGG + Intergenic
950228328 3:11254492-11254514 CAAGGTAAGAAAAACCTTGGGGG - Intronic
950577759 3:13842980-13843002 CAAGGACTGAAAGACCTAGGTGG + Intronic
951048389 3:18066751-18066773 CATGATGTGAAATACCTAAGGGG + Intronic
954210232 3:49093157-49093179 CAAGGTGAGGAAATCCGAAGGGG + Intronic
955141125 3:56271046-56271068 TACGTTGTGAAAAACTTAAGTGG + Intronic
958954361 3:100451337-100451359 AAAGGTGGGAAAACCCAAAGTGG + Intronic
962035739 3:131649736-131649758 TAAGGTATGCAAAACCTAAGGGG + Intronic
963391814 3:144674313-144674335 AAAGGTGTGAAAAAGCTATCTGG - Intergenic
963590770 3:147255703-147255725 CATTGCCTGAAAAACCTAAGCGG + Intergenic
964071900 3:152645586-152645608 CATGGTCTGAAAATACTAAGTGG - Intergenic
965175980 3:165333128-165333150 AAAGATGTGAAAATTCTAAGGGG - Intergenic
967393311 3:188978809-188978831 CAAGGACTGAAAAATCTAAGAGG + Intronic
970231179 4:13912874-13912896 CAGGGTGTGAAAAAATAAAGTGG + Intergenic
972152435 4:36110492-36110514 CAAGATGTGAAAAACCTAGAAGG + Intronic
976050257 4:81003735-81003757 CAAAGTGTGAAAAGCACAAGCGG + Intergenic
976660209 4:87532897-87532919 CAAGGTATTAAAAACATAATGGG - Intergenic
979488895 4:121301472-121301494 AAAGGAGTGAAAAACCTGGGTGG - Intergenic
980712011 4:136581246-136581268 CAAAGTCTGAGAAACCTGAGAGG - Intergenic
984914285 4:184707212-184707234 AAAGCTGTGAAAACCCTGAGGGG + Intronic
992284640 5:75221565-75221587 CAAAGGGTGAAAAACATAAGAGG + Intronic
993077782 5:83255917-83255939 CAAGGTGTAAAAATCCCATGAGG - Intronic
993878149 5:93332537-93332559 CAAGGTGTTTACAACCCAAGTGG + Intergenic
994133706 5:96261279-96261301 CAAAGTCTGAGAAAGCTAAGAGG + Intergenic
994673339 5:102789370-102789392 AAAGGTGGAAACAACCTAAGTGG + Intronic
994994426 5:107041750-107041772 CAAGGTGTTAAAGTCCTCAGAGG + Intergenic
995429603 5:112059241-112059263 GAAGGGGTGAAAAATCCAAGAGG + Intergenic
999553929 5:152720647-152720669 CAAGGTAAGAAAAACCACAGGGG + Intergenic
1000456915 5:161460833-161460855 CAAGGTGCGAAATATCTAACTGG + Intronic
1006077203 6:31541513-31541535 CAAGGTGAGAAAAATCCAACTGG + Intronic
1012828107 6:104171078-104171100 CAAGGTGTTTATAACATAAGTGG + Intergenic
1014877836 6:126683399-126683421 CAAAGTGAGAAAAATCTTAGTGG + Intergenic
1016283610 6:142448210-142448232 CATTGTGTGAATAACCCAAGTGG + Intergenic
1016302542 6:142648193-142648215 CAAGATATGAAAAACGGAAGAGG + Intergenic
1016696798 6:147005640-147005662 CAAGGTGTGAAAACCATGATAGG + Intergenic
1016946264 6:149537257-149537279 CTAGCTGTGAAAGTCCTAAGTGG - Intronic
1017769075 6:157631250-157631272 CCAGGTGAGTAAAACCTTAGAGG - Intronic
1024265405 7:47602514-47602536 CAAGGTGGGAGGAACCAAAGGGG - Intergenic
1024462132 7:49669912-49669934 GATGGTGTGAAAATGCTAAGTGG + Intergenic
1025318968 7:58070867-58070889 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1025554743 7:62292187-62292209 AAAGATTTAAAAAACCTAAGCGG + Intergenic
1025560038 7:62361089-62361111 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1025562896 7:62392659-62392681 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1025564125 7:62410084-62410106 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1025877413 7:65495977-65495999 AAAGATTTAAAAAACCTAAGCGG + Intergenic
1027721181 7:81743550-81743572 CTAGGTGTAGACAACCTAAGTGG - Intronic
1030033862 7:105391934-105391956 AAAGGTGGAAAAAACCTAAATGG + Intronic
1031270286 7:119640777-119640799 CAAGTTCTGAAATACCTTAGAGG + Intergenic
1035841107 8:2812548-2812570 CAACGTGTGAGAAACCATAGCGG + Intergenic
1042935875 8:74057666-74057688 CAGGATGAGAGAAACCTAAGTGG - Intergenic
1043162491 8:76863305-76863327 CAAGGTGAAAAAAATCAAAGAGG + Exonic
1051660287 9:19419838-19419860 CCAGGTCTGAAATACCTAAGTGG - Intronic
1051974939 9:22938025-22938047 AAAGGTGTAAGAAACCTGAGAGG - Intergenic
1052183546 9:25562080-25562102 AAAGGTGAGACAACCCTAAGTGG + Intergenic
1052818573 9:33121264-33121286 CAAGGTGTGCAAGACAGAAGAGG + Intronic
1203614171 Un_KI270749v1:40377-40399 AAAGATTTAAAAAACCTAAGCGG - Intergenic
1186673271 X:11788834-11788856 CAAAGTGTCATAAACCTTAGAGG - Intergenic
1187962260 X:24577904-24577926 CAAGCTGTTAAAAAGCAAAGAGG - Intronic
1194875756 X:99185798-99185820 TATGGTGTGAAAAAACTGAGAGG + Intergenic
1196038514 X:111174351-111174373 CAAGATGAGAAGACCCTAAGGGG + Intronic
1197146442 X:123177657-123177679 CAAGGTGTCCCAAACCTTAGTGG + Intergenic
1198280181 X:135133780-135133802 CAAGGTTGCAAAAACCTTAGAGG + Intergenic
1198290777 X:135238734-135238756 CAAGGTTGCAAAAACCTTAGAGG - Intergenic
1200834620 Y:7721193-7721215 CAGGGTGTGTCAAATCTAAGAGG - Intergenic