ID: 1099362133

View in Genome Browser
Species Human (GRCh38)
Location 12:81717403-81717425
Sequence TGCAGGAAATCCAACACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099362130_1099362133 -5 Left 1099362130 12:81717385-81717407 CCTAAATCATCATAGAACTGCAG 0: 1
1: 0
2: 0
3: 9
4: 224
Right 1099362133 12:81717403-81717425 TGCAGGAAATCCAACACTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 129
1099362128_1099362133 23 Left 1099362128 12:81717357-81717379 CCATAGATCATAGTTTGCTAGCT 0: 1
1: 0
2: 2
3: 19
4: 139
Right 1099362133 12:81717403-81717425 TGCAGGAAATCCAACACTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 129
1099362127_1099362133 24 Left 1099362127 12:81717356-81717378 CCCATAGATCATAGTTTGCTAGC 0: 1
1: 0
2: 0
3: 27
4: 190
Right 1099362133 12:81717403-81717425 TGCAGGAAATCCAACACTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099362133 Original CRISPR TGCAGGAAATCCAACACTGG TGG Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
909586332 1:77292729-77292751 TGCAGGAAATATAACACAGTTGG - Intronic
909627064 1:77729409-77729431 TGCCTGTAATCCAACACTGTGGG + Intronic
911627779 1:100145622-100145644 GCCTGGAAACCCAACACTGGAGG + Intronic
913208651 1:116565046-116565068 TGCAGGAAAGGAATCACTGGGGG - Intronic
914349616 1:146829464-146829486 AGCAGAAAATCCAACATTAGTGG + Intergenic
916121928 1:161536133-161536155 TGCTGTCAATCCAACAATGGAGG + Intergenic
916131820 1:161617557-161617579 TGCTGTCAATCCAACAATGGAGG + Intronic
916160588 1:161908860-161908882 TGAAGGAAATTCAATTCTGGAGG - Intronic
918611232 1:186494716-186494738 TGTTGGAAATTTAACACTGGAGG - Intergenic
919634493 1:199990224-199990246 TGCCTGTAATCCAACACTGTTGG - Intergenic
920575223 1:207054159-207054181 TCCTGGAATTCCAACACTTGGGG - Intronic
922897512 1:229111885-229111907 CACAGAAAATCCCACACTGGAGG - Intergenic
1063056126 10:2506489-2506511 TGCCTGAAATCCAACACTTTGGG + Intergenic
1064195085 10:13237750-13237772 TGCAGCACATCCAGCCCTGGTGG - Intergenic
1066380424 10:34896589-34896611 AGCAGGAAGTCCAGCACAGGAGG + Intergenic
1071038252 10:81274240-81274262 TGCATGAAATCCAACATAAGTGG - Intergenic
1073041268 10:100608433-100608455 TCCAGGAAATCCACCCCTGTGGG - Intergenic
1073092558 10:100954681-100954703 TGCCTGTAATCCAACACTTGGGG + Intronic
1074216385 10:111388759-111388781 TGGGGGATATCAAACACTGGGGG - Intergenic
1074276711 10:112009548-112009570 TGCAGGACTTCAAACACTGTGGG - Intergenic
1076987784 11:251913-251935 TGTTGCAAATCCAACACTCGGGG - Exonic
1078889595 11:15542541-15542563 TCCAGGCAATCCAATGCTGGAGG - Intergenic
1081058594 11:38443669-38443691 TGAGGGAAAACCAACACTTGTGG - Intergenic
1083017533 11:59470841-59470863 TGAAGCAAATGCAACACTGCTGG + Intergenic
1083934369 11:65862654-65862676 TCCAGGTATTCCAACAGTGGGGG - Intronic
1089570225 11:119402809-119402831 TGCAGAACAGCCAACACTGGAGG - Intergenic
1091472733 12:743596-743618 TGTAGAAAACCCAAAACTGGCGG - Intergenic
1091605348 12:1946953-1946975 TGCCTGTAATCCAACACTTGGGG - Intronic
1093747718 12:22762060-22762082 TTGAGGAAAGCCAAGACTGGGGG - Intergenic
1094687046 12:32728119-32728141 TGCAAGATGTCCAACAGTGGGGG - Intronic
1095708660 12:45265249-45265271 TACAGTAGATCCAACACGGGAGG - Intronic
1096354875 12:50932000-50932022 TGCAGGAAAACAAACTTTGGTGG - Exonic
1097686545 12:62696391-62696413 TGATTGAAAACCAACACTGGCGG - Intronic
1099362133 12:81717403-81717425 TGCAGGAAATCCAACACTGGTGG + Intronic
1101293330 12:103394684-103394706 AGCAGGAAAGCAAGCACTGGAGG + Intronic
1101895833 12:108755899-108755921 TGCCTGTAATCCAACACTTGGGG - Intergenic
1107665574 13:42686522-42686544 TGCAGGAAATTTAAAACTAGAGG + Intergenic
1107945149 13:45411463-45411485 TCCAGGAAAAACAGCACTGGAGG - Exonic
1108493759 13:51005162-51005184 AGCAGGAAATCCAAGGCTGCTGG + Intergenic
1111475121 13:88735772-88735794 TGCAGGAAATCTGACAATGGTGG - Intergenic
1112353398 13:98655034-98655056 TCCAGGAAATCCAGGACTAGGGG - Intergenic
1116888430 14:50242943-50242965 TGGAGGCAATCCAACCCTGATGG - Exonic
1117412475 14:55463245-55463267 TACAGGAAATCCAAAATTTGAGG - Intergenic
1117454566 14:55884368-55884390 TGGAGGAAATCCAACATGGAAGG - Intergenic
1120643742 14:87046986-87047008 AAGAGGAAATTCAACACTGGAGG + Intergenic
1121150270 14:91626704-91626726 GGTGGGAAATCCAAGACTGGGGG - Intronic
1124106598 15:26743601-26743623 TGAAGAAAATCCAACATTGTGGG + Intronic
1126743504 15:51801572-51801594 TGCTGAGAATCCACCACTGGGGG + Intronic
1128242862 15:66113316-66113338 TTCAGGAAATCCAGAAGTGGAGG - Intronic
1134305081 16:13024538-13024560 TGCATGAATCCCAGCACTGGTGG - Intronic
1135236778 16:20764143-20764165 TTCAGGAAATCTTACACAGGAGG - Intronic
1139984420 16:70886083-70886105 AGCAGAAAATCCAACATTAGTGG - Intronic
1141917299 16:87108071-87108093 CGGAGGACATCCAACACAGGTGG + Intronic
1142850187 17:2701013-2701035 AGCGGGGACTCCAACACTGGGGG + Intronic
1143592750 17:7895361-7895383 TGCAGAAGATCCTACATTGGCGG + Exonic
1147176713 17:38660377-38660399 TGCAGGAGATCGCACACTCGAGG + Intergenic
1149538374 17:57450126-57450148 TTCAGTAAATTCAACATTGGAGG + Intronic
1150985923 17:70197099-70197121 TTGAGGAAATCCTACAGTGGAGG - Intergenic
1151834482 17:76574015-76574037 TGCAGGAACCCCCACACTGCAGG - Intronic
1155380347 18:25215738-25215760 TGCAGCAAATTCAATAATGGGGG + Intronic
1156765532 18:40650249-40650271 TGTAAGAAATTCAAAACTGGGGG + Intergenic
1159772975 18:72569829-72569851 TCCAACACATCCAACACTGGGGG + Intronic
1164658407 19:29941366-29941388 TTCAGGGAATCCAAGACAGGAGG + Intronic
1167406066 19:49309623-49309645 TTCAAGGAATCCAATACTGGTGG + Intronic
1168515164 19:57004656-57004678 TGCTGGACAGCCAACTCTGGAGG - Intergenic
931108645 2:59085981-59086003 TGGAGGAAATCCAGGATTGGAGG + Intergenic
933807901 2:86013294-86013316 TGCAGCATATCCCACACAGGAGG + Intergenic
936737030 2:115457717-115457739 TGGTGGAAATACAACACTTGGGG + Intronic
938309063 2:130274313-130274335 AGCAGGAAATCTAACACATGCGG + Intergenic
938475968 2:131613894-131613916 TGGAGGAAAAACAACTCTGGAGG - Intergenic
1169778049 20:9277513-9277535 TGCAGGAAATCTGGCATTGGAGG - Intronic
1173952733 20:47006153-47006175 TGCAGGAAGTCCTAGACAGGAGG - Intronic
952219381 3:31309362-31309384 AATAGGGAATCCAACACTGGAGG - Intergenic
952726917 3:36596343-36596365 TGCAGAAAATTCTCCACTGGGGG + Intergenic
956435068 3:69227053-69227075 TTCAATAAATCCAACACAGGTGG - Intronic
958859902 3:99433945-99433967 TGAAGGAAATCCACTACTGTAGG + Intergenic
960879267 3:122328547-122328569 GGCAGGCAGTCAAACACTGGGGG - Intronic
962595077 3:136934067-136934089 AGCAGGAACTCCATCAATGGTGG - Intronic
962850396 3:139304104-139304126 GGCAAGAAATCCAAGACAGGTGG - Intronic
964177044 3:153836558-153836580 TGTAGTAATTCCAACACTCGGGG + Intergenic
964444774 3:156747540-156747562 ACAAGGAAATCCAACACTGAGGG - Intergenic
964738728 3:159943435-159943457 TTCAGGAGATGTAACACTGGAGG + Intergenic
964912992 3:161804428-161804450 TGCAGGAAATCCATCCCCAGTGG - Intergenic
966342890 3:178945215-178945237 AGAAGGAAATGCAACACAGGTGG - Intergenic
966640038 3:182179515-182179537 TGCAGAAAATCCAACCCTGCAGG + Intergenic
969258025 4:6015801-6015823 TGCATGCAATCCCACACTGGCGG + Intergenic
969301580 4:6300345-6300367 TGCAAGACCTCCAGCACTGGAGG - Intronic
970685236 4:18559620-18559642 TGCAGCAGATCCAACACTCACGG + Intergenic
971144778 4:23964742-23964764 TGGAGGGGAACCAACACTGGAGG + Intergenic
976130877 4:81882664-81882686 GGCAGGAGATACAACACAGGGGG - Intronic
979701320 4:123670836-123670858 AGCAGGAAAGCCATCACTGTAGG - Intergenic
983310223 4:166050686-166050708 TGAAGGAAAGCCAGCCCTGGAGG - Intronic
985195271 4:187421652-187421674 TGCAGGAATTACAAGACTCGAGG + Intergenic
985758015 5:1730676-1730698 TTCAGGGAATTCAACCCTGGGGG - Intergenic
988362862 5:30257668-30257690 TGCAGGTAACCCAACAGTTGCGG - Intergenic
989616332 5:43340412-43340434 TGCAGGAGTTCTAACTCTGGTGG + Intergenic
989762740 5:45038560-45038582 TGCAGGAGATTTAACACTAGGGG + Intergenic
990294414 5:54386061-54386083 AACAGGAAATCCAACCCTGAGGG + Intergenic
991456633 5:66810997-66811019 TGCAGGAAAAACATCACTAGGGG + Intronic
993955650 5:94229107-94229129 AGCAGGAAATCTAACACAGGAGG - Intronic
994358682 5:98825308-98825330 ACCAGGGAATCCAACACAGGAGG + Intergenic
997216012 5:132111161-132111183 TGCAGGAAATGGAATTCTGGGGG + Intergenic
999491885 5:152059236-152059258 TACCGGAAAGCTAACACTGGAGG + Intergenic
1001246550 5:170109267-170109289 TGCAGGAAACTCAGCCCTGGTGG + Exonic
1003572709 6:7266487-7266509 TGCTGGATATCCAGCTCTGGGGG - Intergenic
1005455488 6:26016208-26016230 TGCAGGATTTTCAACCCTGGTGG - Intergenic
1006931689 6:37692592-37692614 TGCAGGAAATCAATACCTGGGGG - Intronic
1007784821 6:44273526-44273548 TGCAGGACATTCAACATGGGAGG + Intronic
1009198240 6:60712709-60712731 AGCAAGAAATCCAACGATGGTGG + Intergenic
1009588044 6:65631364-65631386 TGGAGGAAATAACACACTGGAGG - Intronic
1017556797 6:155580343-155580365 TGCATGAAATGCAACAGTGCCGG + Intergenic
1019096036 6:169579904-169579926 TGCAGGAAATCCCAAAATTGGGG - Intronic
1019653513 7:2173689-2173711 AGCAGGATATCCGTCACTGGGGG - Intronic
1019735541 7:2648264-2648286 TGCAGGAAATCAAGGGCTGGGGG - Intronic
1023330999 7:39116747-39116769 ATCAGGATATCTAACACTGGAGG - Intronic
1023468062 7:40480456-40480478 AGCAGGAAAAGCAAAACTGGCGG - Intronic
1028713675 7:93939766-93939788 AGCAGCAACTCCAACACTGAAGG - Intergenic
1032349428 7:131146627-131146649 TGCAACAAATACAACATTGGCGG + Intronic
1033440512 7:141373942-141373964 GGCATGAAATCCAACTCTGGGGG + Intronic
1038217480 8:25575747-25575769 TGTTGGAACTTCAACACTGGAGG + Intergenic
1039409260 8:37338844-37338866 TGCAGAAATTCCACCAATGGTGG - Intergenic
1039845660 8:41323796-41323818 TGCAGAAAATCCAGCCCTGCTGG - Intergenic
1043094508 8:75949403-75949425 ACCAGGAAATCCAACATTGGAGG + Intergenic
1044880810 8:96720220-96720242 TTCTGTAAATCCAACACTTGCGG + Intronic
1045393014 8:101733824-101733846 TGCAGGAAAACCCTCAGTGGGGG - Intronic
1050029888 9:1374673-1374695 TACAGGATATCCAACACAGGGGG + Intergenic
1050331095 9:4546994-4547016 TGCAGCAAACCCAAAACTCGAGG + Intronic
1050447708 9:5743545-5743567 TGCATGAAATACAAAACTGTGGG - Intronic
1052598147 9:30588585-30588607 TTCAGGAATACCAACATTGGAGG - Intergenic
1060212251 9:121717785-121717807 AGCAGGAAGTCCAGGACTGGAGG - Intronic
1188984403 X:36756463-36756485 AGCAGGAAATGCATCAGTGGAGG - Intergenic
1189375344 X:40462116-40462138 TGCACTGAATCCCACACTGGTGG - Intergenic
1190153360 X:47966965-47966987 TGCACAAAATCCAAGAATGGAGG + Intronic
1190981613 X:55461132-55461154 TGCAGATAATCCAACCGTGGTGG - Intergenic
1190987085 X:55512048-55512070 TGCAGATAATCCAACCGTGGTGG + Intergenic
1191863032 X:65681457-65681479 TGCAGGGGATCCAACAGTGTTGG + Intronic
1194443211 X:93958226-93958248 TGCAGGAAATAAAACTCTCGAGG - Intergenic