ID: 1099362498

View in Genome Browser
Species Human (GRCh38)
Location 12:81722455-81722477
Sequence TTGACCTTTATTAAAATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099362497_1099362498 4 Left 1099362497 12:81722428-81722450 CCAAATCTAAATAGGCTAGATCT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1099362498 12:81722455-81722477 TTGACCTTTATTAAAATTACAGG 0: 1
1: 0
2: 3
3: 20
4: 334
1099362496_1099362498 5 Left 1099362496 12:81722427-81722449 CCCAAATCTAAATAGGCTAGATC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1099362498 12:81722455-81722477 TTGACCTTTATTAAAATTACAGG 0: 1
1: 0
2: 3
3: 20
4: 334
1099362495_1099362498 6 Left 1099362495 12:81722426-81722448 CCCCAAATCTAAATAGGCTAGAT 0: 1
1: 0
2: 5
3: 243
4: 4287
Right 1099362498 12:81722455-81722477 TTGACCTTTATTAAAATTACAGG 0: 1
1: 0
2: 3
3: 20
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099362498 Original CRISPR TTGACCTTTATTAAAATTAC AGG Intronic
901576346 1:10204226-10204248 CTGACCTTGGTTAAAATAACTGG + Intergenic
902969838 1:20039400-20039422 TTGTCCTCTATGAACATTACTGG - Intronic
903887514 1:26549266-26549288 TTGACTTTTATTAAAAGGAGAGG - Intronic
906016096 1:42581295-42581317 GTGACCTTTTTTCAAATTAGGGG - Intronic
907591076 1:55671927-55671949 ATGGCCTTAATTACAATTACAGG + Intergenic
908310436 1:62876117-62876139 TTGAACTTCATTTAATTTACAGG + Intergenic
908506402 1:64805735-64805757 TTGACTTTTTTTTAAATTATTGG - Intronic
909316791 1:74231156-74231178 TTAATCTTTATTAAAAATAAAGG + Intronic
910436949 1:87215067-87215089 TAGACCTAAAATAAAATTACCGG - Intergenic
910953646 1:92678192-92678214 TTGACCTTTATTTTAAATTCAGG - Intronic
911159048 1:94665326-94665348 TTGACCTAAAATAAAATAACTGG - Intergenic
911395017 1:97294887-97294909 GTGACCCTTGTTAAAATTATGGG - Intronic
911977532 1:104518803-104518825 ATGACTTTTATCAAAATTACAGG + Intergenic
914415975 1:147482537-147482559 TTCACCTTCTTTAATATTACAGG + Intergenic
918481274 1:184979139-184979161 TTGACTTTTATTTTAATTTCAGG - Intergenic
918507251 1:185269546-185269568 TTGGCCTTTATTACACTTGCGGG - Intronic
918953807 1:191178318-191178340 TTGATAGTGATTAAAATTACTGG + Intergenic
919025832 1:192168792-192168814 TTCATCTTATTTAAAATTACAGG - Intronic
919076081 1:192814451-192814473 TTGACCTTTAATAAAAGAAGAGG + Intergenic
919644088 1:200075361-200075383 TCAACCTATATTAAAACTACTGG - Intronic
921861165 1:220043765-220043787 TTGACCTTTCTGAAGATAACAGG - Intronic
923210145 1:231796591-231796613 GTGACCTTTAGCAAAATCACTGG - Intronic
923878781 1:238080426-238080448 TTTATATTTAATAAAATTACTGG + Intergenic
924480250 1:244424651-244424673 TTGACCTTTGTTAAATTTTAGGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064658934 10:17586228-17586250 TAAACCTTTAGCAAAATTACTGG - Intergenic
1064791710 10:18963795-18963817 TTCTCCTTTATTAAAGTTCCTGG + Intergenic
1065355963 10:24842138-24842160 TTGACCTTTATAAAAACTCTGGG - Intergenic
1065563402 10:26985634-26985656 TTGACAATTATAAAAATTCCAGG - Intergenic
1065819077 10:29508698-29508720 TTCACCTTTCTTGAAATTTCGGG + Intronic
1065953744 10:30675225-30675247 TTCACCTTTCTTAAAATTTCAGG - Intergenic
1066130900 10:32392796-32392818 TGGACCTTCATTTAAATTACTGG - Intergenic
1066179986 10:32951903-32951925 TTCTCCTTAATTGAAATTACGGG - Intronic
1066295793 10:34053384-34053406 TTGACATTTTTGAAGATTACAGG - Intergenic
1068318039 10:55373260-55373282 GATACCTTTATTAAAAATACAGG + Intronic
1068417531 10:56743660-56743682 TTGACATATATTAAACTTACAGG + Intergenic
1068866391 10:61900126-61900148 TTGATCTGTGATAAAATTACAGG - Intergenic
1068896971 10:62215322-62215344 TTGACATTTTTTAAAAGTCCAGG - Intronic
1070193690 10:74136511-74136533 TTGGCCATAATTAAAGTTACTGG - Intronic
1072315704 10:94200915-94200937 TTGACATTTTTGAGAATTACTGG - Intronic
1073375292 10:103029161-103029183 TTAAGCTTTATTAAAAGTATTGG + Intronic
1073787072 10:106901399-106901421 TTCAACTTTATAAAAATTAAAGG + Intronic
1075140009 10:119824368-119824390 TTGACATTTTTTAAGAGTACTGG + Intronic
1075380183 10:122012561-122012583 TTGAATTCTATTAAAATAACTGG - Intronic
1075979478 10:126724453-126724475 TTGACCTTGTTGAAACTTACTGG - Intergenic
1077748984 11:4942388-4942410 TAGACCTGAATCAAAATTACAGG + Intronic
1078118116 11:8476284-8476306 TAAACCTTTATTAAAATCAGAGG + Intronic
1079149983 11:17889497-17889519 TTGACATTTTTTAAGAGTACAGG - Intronic
1081509607 11:43756925-43756947 TTGACCTTTATTAAAAGGCATGG + Intronic
1083194610 11:61077934-61077956 ATGACCTTTGTTAAAAATTCAGG - Intergenic
1085928684 11:81054804-81054826 TTGACCTTTTATAGAATTAAAGG + Intergenic
1087358504 11:97125789-97125811 TTTACCTTTATTAAACTAAACGG + Intergenic
1087609610 11:100418205-100418227 TTGACCTTTACCTAAATTATTGG + Intergenic
1087862924 11:103185538-103185560 TTGACCTCTACTGAAATTATTGG + Intronic
1088185642 11:107166138-107166160 TTGACATTTATTAATATTTATGG + Intergenic
1088818271 11:113435814-113435836 TTGACCTTTACTTTAATTTCAGG + Intronic
1088940663 11:114452382-114452404 TTGAATTTTAATAAAATAACTGG + Intergenic
1090708825 11:129366605-129366627 TTGAGCTATAGTAAAATTTCTGG + Intergenic
1092114899 12:5993279-5993301 TTGGCATTTATTTAAAGTACAGG - Intronic
1092152287 12:6258421-6258443 TTGACAATTCCTAAAATTACAGG - Intergenic
1096644247 12:53020864-53020886 TAGATTTTTATTAACATTACTGG + Intronic
1096932776 12:55232846-55232868 CTGTACTTTATTAAAATTAAAGG + Intergenic
1097731171 12:63130343-63130365 TTTTCTTTTTTTAAAATTACTGG - Intergenic
1098512203 12:71329727-71329749 TAGGCCTTTATTAAAATAATTGG + Intronic
1098683663 12:73391829-73391851 GTGAAATTTATTAAAATTTCAGG - Intergenic
1098735892 12:74103984-74104006 TAGATTTTTATTAAAAATACTGG + Intergenic
1098981264 12:76959074-76959096 ATGACTTTTATTATAATAACTGG + Intergenic
1099017983 12:77368148-77368170 TTTACATTTAGTATAATTACTGG + Intergenic
1099362498 12:81722455-81722477 TTGACCTTTATTAAAATTACAGG + Intronic
1099799383 12:87438375-87438397 TTTCCCTTTATTAAAATCAGAGG - Intergenic
1099908766 12:88803915-88803937 GTGACCTTCACTAAGATTACAGG + Intergenic
1100163620 12:91891696-91891718 TTCACATTTATTAAACTTCCAGG + Intergenic
1100595017 12:96064223-96064245 TTTTCCTTTATTTAAATAACAGG + Intergenic
1100622231 12:96288950-96288972 GTTAACTTTATTCAAATTACTGG - Intronic
1103171093 12:118820641-118820663 TTGACTTTGTTTAGAATTACTGG + Intergenic
1104008156 12:124909815-124909837 TTTACCTTTTTTAAAAATAGGGG - Intergenic
1105235719 13:18551182-18551204 TTGGACTTCATTAAAATTAAAGG - Intergenic
1106129560 13:26928889-26928911 TTTACATTTATTGTAATTACTGG - Intergenic
1108070924 13:46627875-46627897 ATGACCTGTATTACCATTACAGG + Intronic
1108084731 13:46774300-46774322 TTGACATTTTTTAAAATTCTTGG - Intronic
1109445329 13:62430421-62430443 GTGACCTTATTTAGAATTACAGG - Intergenic
1109531289 13:63651557-63651579 ATGACCTAAATCAAAATTACTGG - Intergenic
1109864721 13:68248080-68248102 TTGGCCATTATTACAATTAGAGG - Intergenic
1110490817 13:76104115-76104137 TTAATCTTTTTTAAAATGACAGG + Intergenic
1110574941 13:77044751-77044773 TTGCACTTCATTAAAATTTCAGG + Exonic
1111456565 13:88492256-88492278 TTTACCATTATTAAAATTAAGGG + Intergenic
1114920716 14:27324690-27324712 TTCCACTTTTTTAAAATTACTGG + Intergenic
1115038852 14:28895600-28895622 TTGACCTTTATGAATATTCATGG + Intergenic
1115725188 14:36206799-36206821 TTGAGATTTTTGAAAATTACAGG + Intergenic
1117486997 14:56207902-56207924 TGGACCTTTATCCAAATGACAGG + Intronic
1117686993 14:58263486-58263508 TATACCTTTATTAAAAATACAGG + Intronic
1118070101 14:62237149-62237171 TTAAACATTATTAAAATTAAAGG - Intergenic
1118789237 14:69074217-69074239 ATGACCTTTAGGAAAATTAGAGG - Intronic
1119054944 14:71409533-71409555 TTCACCTTTAGTAAAAGGACTGG + Intronic
1119629243 14:76212223-76212245 TTTACTTTTATTAATATGACAGG - Exonic
1120167174 14:81213750-81213772 TTTACCTTGAGAAAAATTACAGG - Intronic
1120791232 14:88585194-88585216 GTCACATTTATTACAATTACTGG + Intronic
1121917569 14:97849908-97849930 TTGACATTTATGAACAGTACAGG - Intergenic
1122312384 14:100805364-100805386 TTAACCTTTAAGACAATTACAGG - Intergenic
1122620390 14:103054034-103054056 TTGACATTTATTATAGATACTGG + Intronic
1123805321 15:23865748-23865770 TTGACACTTTTTAGAATTACTGG + Intergenic
1123854680 15:24396283-24396305 TTGACTTTTTTGAAAAGTACAGG + Intergenic
1123870706 15:24569235-24569257 TTGACTTTTTTGAAAAGTACAGG + Intergenic
1124586214 15:31011260-31011282 TTTACATTTAATATAATTACTGG + Intronic
1124656517 15:31513555-31513577 TTGACATTTTTGAAGATTACAGG + Intronic
1125189898 15:36978947-36978969 TTAACTTTTAAGAAAATTACTGG + Intronic
1125332781 15:38598508-38598530 TTGCTCTTTATTTAAATAACAGG + Intergenic
1126335574 15:47583283-47583305 TTAACTTTTATAAAAATCACTGG - Intronic
1126480742 15:49117356-49117378 TTGTCATTTATAAAAATTAAAGG + Intronic
1127282934 15:57507370-57507392 TGGACCTATATTTTAATTACAGG + Intronic
1128666456 15:69541712-69541734 TTGATATTTTTTAAAATTAGAGG - Intergenic
1128851760 15:70965522-70965544 CTGATATTTATGAAAATTACAGG + Intronic
1129128487 15:73467254-73467276 CTGACATTGATTAGAATTACTGG + Intronic
1130079856 15:80723388-80723410 GTCAGCATTATTAAAATTACAGG - Intronic
1131757442 15:95580694-95580716 TTAATATTTATTAAAATTTCTGG - Intergenic
1133725857 16:8536905-8536927 TTTACTTTTATTAAACATACAGG + Intergenic
1135997700 16:27264775-27264797 TTGACTTTTGTTAAAATTAAGGG + Intronic
1146264860 17:31446058-31446080 TTGACCTTTTTAAAAACTTCAGG + Intronic
1148361148 17:47013461-47013483 TTGAGCATTTTTAAAATTTCTGG + Intronic
1150015103 17:61548642-61548664 TTTACATTTATTAAGAATACCGG + Intergenic
1150658600 17:67056595-67056617 TTGTCCTTTATGAACATTGCAGG + Exonic
1154513821 18:15138816-15138838 TTGGACTTCATTAAAATTAAAGG + Intergenic
1158167007 18:54551848-54551870 TTGACCTAAAATAAAATGACTGG - Intergenic
1158359681 18:56657909-56657931 GTGACGTTTAATGAAATTACAGG + Intronic
1158586659 18:58744028-58744050 TTGTGCTTTATTAAAAATTCTGG + Intronic
1158842943 18:61407766-61407788 TTGACATTTGTTAAAAGTACTGG - Intronic
1159009944 18:63049378-63049400 TTGGCTTTTATTATAATTAAAGG - Intergenic
1159500742 18:69266076-69266098 TTTTCCTCTCTTAAAATTACAGG + Intergenic
1160119427 18:76114838-76114860 TTAAACTTTTTGAAAATTACAGG + Intergenic
1162669394 19:12242205-12242227 TTGACCTTAAAAAAAATTAAAGG + Intronic
1164930431 19:32171103-32171125 TTGTCCTTTTTTTAGATTACAGG - Intergenic
1165807560 19:38590258-38590280 TTGACCTTTTTAAAAATTAAAGG - Intronic
925095404 2:1194657-1194679 TTCACCTTTATAAAACCTACTGG - Intronic
926458441 2:13098243-13098265 ATGACCTTTATTAAAAAGGCAGG - Intergenic
927811196 2:26181105-26181127 TTCAGCTCTATTAAAATAACCGG - Intronic
930940643 2:57010071-57010093 TTCACCTTTGTTAAATTTATTGG - Intergenic
931099974 2:58987091-58987113 TTTACATTTCTTATAATTACTGG - Intergenic
931432474 2:62219235-62219257 TAGACCTTTACCAAAATTTCTGG - Intronic
931961029 2:67483219-67483241 TTGACCATTCTGAAAATTCCAGG + Intergenic
933350781 2:81149871-81149893 TTTACCTAAATTAAAATTCCAGG + Intergenic
933535498 2:83567953-83567975 TTGACTTATAATAAAATCACTGG + Intergenic
934118759 2:88820324-88820346 TTCAACTGCATTAAAATTACAGG - Intergenic
935477811 2:103545573-103545595 TTCAACTGTATTAAAATTAGTGG + Intergenic
935829751 2:106988704-106988726 ATCACCTTTATTTTAATTACGGG + Intergenic
935989019 2:108702875-108702897 TTGAGCTTTATTAAAATTAAAGG + Intergenic
936851019 2:116897833-116897855 ATGACCTTTATCAAAAAGACAGG - Intergenic
937566963 2:123305734-123305756 GAGACGTTGATTAAAATTACAGG - Intergenic
942715903 2:178891731-178891753 TTCACCTAAATTAAAATTGCAGG - Intronic
943199778 2:184805765-184805787 TTGACATTTATTAAAATGTGAGG + Intronic
943367540 2:186980387-186980409 TTGTCCTTTATTAAACTTACAGG + Intergenic
944086843 2:195858354-195858376 TTCAGCTTCATTAAAATTTCAGG + Intronic
944117108 2:196200330-196200352 TTTACCTTTATAAAAATAAAAGG + Exonic
944915108 2:204351677-204351699 TTGGCCATTATTGTAATTACTGG - Intergenic
945128320 2:206538182-206538204 TTTACCTTCATTAAATTTAATGG - Intronic
945370791 2:209014893-209014915 TTGACCTTTTTTAAAAAAATAGG - Intergenic
945402966 2:209409501-209409523 TTTACATGTATTATAATTACTGG - Intergenic
945490119 2:210444774-210444796 TTGACCTTTTTTAAAACAATAGG + Intronic
945503492 2:210608271-210608293 TTGGTCTTTCTTAAAATTTCTGG - Intronic
945704730 2:213214738-213214760 TTGAAAGTTATTATAATTACCGG - Intergenic
945786400 2:214243973-214243995 TTGAACTTTAGAAACATTACTGG - Intronic
946091541 2:217229339-217229361 TTGACCATTCTGAAAATTCCAGG - Intergenic
1169312598 20:4558805-4558827 TTAGACTTTATTAAAATTAAAGG + Intergenic
1169887681 20:10419080-10419102 TTGACTTTTGGTATAATTACTGG - Intronic
1174175947 20:48644966-48644988 TTCACCTTTTTGAAAATTAAAGG + Intronic
1174969050 20:55253339-55253361 TTGACTATTATTAACAATACAGG - Intergenic
1175454370 20:59099842-59099864 TTAACCTTTATTTTAATTTCAGG + Intergenic
1176779720 21:13179468-13179490 TTGGACTTCATTAAAATTAAAGG - Intergenic
1177304774 21:19299696-19299718 TTGACACTTATTAAGATTATTGG - Intergenic
1177912667 21:27051836-27051858 TTGTCCTTTCTTAAAATTAGAGG - Intergenic
1177977362 21:27868501-27868523 TTGGACTTCATTAAAATTAAAGG - Intergenic
1178671505 21:34595462-34595484 TTGACCTTTGAGCAAATTACTGG + Intronic
1183751122 22:39721148-39721170 TTGACCTTTAAAAATGTTACAGG - Intergenic
1184138946 22:42566390-42566412 TTGTCGTTTTTGAAAATTACAGG + Intronic
1184446031 22:44547453-44547475 TTGGCCTTTCTTAAAAATAGAGG + Intergenic
950401568 3:12773140-12773162 TTGACCTTTATGACAAATACAGG + Intergenic
951091028 3:18574022-18574044 TTCATCTTTATTAAGAGTACAGG + Intergenic
951364653 3:21766524-21766546 TTGTCCTTTATTTCAATTTCTGG + Intronic
951645153 3:24881627-24881649 TTGATCTTTTTAAAAGTTACTGG + Intergenic
952052078 3:29396279-29396301 TTGACATTTTTTAAAAATATAGG - Intronic
953794270 3:45971676-45971698 TTGACATTTTTGAAAAATACAGG - Intronic
954851256 3:53602624-53602646 ATGACTTTTATCAAAAATACAGG - Intronic
955599308 3:60628056-60628078 TTGAGATTTTTTAAAAATACAGG + Intronic
957301199 3:78393495-78393517 ATGAGATTTATAAAAATTACAGG + Intergenic
957431857 3:80120564-80120586 TTCAACATTATTAAAATTTCTGG + Intergenic
958774433 3:98464648-98464670 TTCACATTTATTAAAATTTTGGG - Intergenic
959408568 3:105992817-105992839 TTCACCTTCATTAAAAAAACAGG + Intergenic
960942900 3:122946120-122946142 TTGACTATAATTAAAATCACAGG - Intronic
961751577 3:129098770-129098792 TTTATTATTATTAAAATTACGGG + Intronic
962089493 3:132228162-132228184 TTGACATTTATAAAAAATCCTGG - Intronic
962597585 3:136962445-136962467 TTGACATTTTTTAGAAGTACTGG - Intronic
963197889 3:142553917-142553939 TGGAACTTTATTAAATTTAATGG - Exonic
963336803 3:143984637-143984659 TTCACCTTAAGTAAAATAACAGG - Intronic
963370487 3:144393376-144393398 ATTACCTTTATTAAGTTTACTGG - Intergenic
963459073 3:145584365-145584387 TTGACCTTTATTGTATTAACTGG + Intergenic
964542508 3:157795252-157795274 TGGACCTTAATTAAAATTTGTGG + Intergenic
965441600 3:168721787-168721809 TTGATGTTTATCAAAACTACTGG - Intergenic
965892686 3:173534390-173534412 TTGCCCTTCATTCAAATCACTGG + Intronic
965966063 3:174491178-174491200 ATGACCTGTATTAATATTGCTGG + Intronic
966405803 3:179596749-179596771 TTGAACTTTTTTAAAAGTATAGG - Intronic
967065237 3:185909283-185909305 TTGAGCTTTATAGAAGTTACTGG - Intergenic
967074608 3:185990784-185990806 TTGAGCTTTATAGAAGTTACTGG - Intergenic
967672805 3:192259161-192259183 TTGAGCTTGATTAATATGACTGG + Intronic
968246332 3:197152952-197152974 TTGACCTATTTTAAAATAATTGG - Intronic
968685596 4:1956265-1956287 TTGATCTTTATAGAAAATACTGG + Intronic
970020742 4:11565415-11565437 TTGACATGTATCAAGATTACAGG + Intergenic
970502550 4:16693047-16693069 TTGCCTTTTATGAGAATTACAGG - Intronic
971060827 4:22967261-22967283 AAAACCTTAATTAAAATTACTGG - Intergenic
971881094 4:32373688-32373710 AAAACATTTATTAAAATTACTGG + Intergenic
974389081 4:61241557-61241579 TTGATTTTTATTAAATTTATAGG + Intronic
974906283 4:68062220-68062242 TTGATTTTTCATAAAATTACCGG + Intronic
975417959 4:74127916-74127938 ATGGCCTTTATCAAAATGACAGG - Intronic
975570116 4:75807696-75807718 TAGAACTGTATTAAAATTAAAGG + Intronic
976006585 4:80437565-80437587 CTGCCCTTTATTAAAATTTTGGG - Intronic
976177007 4:82364758-82364780 TTATTCTTTACTAAAATTACTGG - Intronic
977799775 4:101213142-101213164 ATGACTTTGATTAAAATTTCTGG - Intronic
977880634 4:102200824-102200846 TTTATATTTATTATAATTACTGG + Intergenic
978252713 4:106652277-106652299 TTGAACTTTATTAAAACCACAGG + Intergenic
978274351 4:106931213-106931235 TTGAGCTATATTAAATTTAAGGG + Intronic
979223315 4:118255077-118255099 TTTAGCTTTAATAAATTTACGGG - Intronic
980796081 4:137685099-137685121 GTGACCTTTATGAAAATCATAGG - Intergenic
981031608 4:140131106-140131128 TTGACCTTCACTGAAATGACTGG - Intronic
981633500 4:146848889-146848911 TTAACCTTTGTTAAAGTGACTGG + Intronic
981898983 4:149839441-149839463 TTTACCATTCTTAAAATTATAGG - Intergenic
983089887 4:163490502-163490524 TTTTCCTATGTTAAAATTACAGG - Intergenic
983604296 4:169568604-169568626 CTGAGCTATATTAAAAATACGGG + Intronic
983727669 4:170949003-170949025 TTGAACTTATTTAAAATGACTGG - Intergenic
983835992 4:172385750-172385772 TTGACTTTTAATGTAATTACTGG + Intronic
984421800 4:179532755-179532777 TTGACATTTATTAAACTTTTGGG + Intergenic
987956092 5:24742276-24742298 TTGACTTTTATGCAAATTAATGG - Intergenic
988214787 5:28257566-28257588 TTGCGTTTTTTTAAAATTACAGG + Intergenic
988481234 5:31632707-31632729 TTGGCCTTTATTTAAGTCACAGG - Intergenic
989479226 5:41909854-41909876 TTTTCCTTTACTAAAATTTCTGG - Exonic
989577233 5:42999825-42999847 TTGCCCATTTTTAAAATTAGAGG - Intergenic
989731262 5:44652744-44652766 TTAACCTTTAATAATATTATTGG - Intergenic
989990722 5:50762268-50762290 TTAACCTTTATTAAATTTGATGG + Intronic
991068181 5:62447037-62447059 TTAAACTTCATTAAAATTAAGGG - Intronic
992381951 5:76246266-76246288 GTTACCTTTGTCAAAATTACTGG + Intronic
993763471 5:91826391-91826413 TAGGCCCTTATTAAAATTTCAGG - Intergenic
993777512 5:92018563-92018585 TTGACATTTATGACAATTATAGG - Intergenic
993821010 5:92617041-92617063 CAGACTTTTATTAAAATTTCAGG + Intergenic
993891579 5:93481942-93481964 TTGAGATTTATTAAAAATATAGG - Intergenic
994117466 5:96076830-96076852 TTGATATTTATTAAAAATAATGG - Intergenic
995638443 5:114223477-114223499 TTCACATTTAATAAAATTAATGG + Intergenic
997077326 5:130694662-130694684 TAGAGTTTTATTAGAATTACAGG - Intergenic
997108923 5:131052441-131052463 TTCAACTTTATAAAAATTGCAGG - Intergenic
997969633 5:138390603-138390625 TTGAGATATATTAATATTACAGG + Intronic
998765302 5:145479736-145479758 TTGTCCTGTATTCAAATTTCTGG + Intronic
998976168 5:147650859-147650881 TTCATCTTTATTAAAATTAATGG - Intronic
999492004 5:152060471-152060493 TTGATCATTTTAAAAATTACTGG + Intergenic
1001346601 5:170906317-170906339 TTGACGTTTATGAAGATTATAGG + Intronic
1003082174 6:3029912-3029934 TTTACCTTTTTTATGATTACAGG - Intergenic
1003906576 6:10705727-10705749 ATCACCTTTTTCAAAATTACTGG - Intronic
1004754251 6:18594426-18594448 TTCACCTTTATTAATTTTTCTGG + Intergenic
1004807123 6:19214816-19214838 TTCATCTGTATTAAATTTACAGG - Intergenic
1006488955 6:34369393-34369415 TTGAACTTTAAGAAAACTACTGG - Intronic
1007977428 6:46115698-46115720 TTGACATTCATTAAAAATAAAGG - Intergenic
1007983754 6:46186863-46186885 TTGACTTTTAGTACAATTAAAGG - Intergenic
1009055196 6:58326730-58326752 TTGGCATTTATGAAAAATACGGG - Intergenic
1009235967 6:61123845-61123867 TTGGCATTTATGAAAAATACGGG + Intergenic
1009799419 6:68515796-68515818 TTTACATTTAATATAATTACTGG - Intergenic
1010897282 6:81379920-81379942 TTGATCTTTATTCAACTGACTGG - Intergenic
1011412230 6:87077763-87077785 TTGACATTTTTTAAGAGTACCGG + Intergenic
1011548192 6:88503165-88503187 CTGACCTTTAGAAAGATTACAGG - Intergenic
1012219922 6:96637395-96637417 TTGACATTTTTAAAAAGTACAGG - Intergenic
1012270692 6:97206411-97206433 TAGACCTTCAGTAAAATTAAAGG + Intronic
1013064416 6:106669796-106669818 TTTGCCTTTATTAAATTTTCAGG - Intergenic
1013411023 6:109883526-109883548 TTGTCATTTATTATCATTACAGG + Intergenic
1013611880 6:111803392-111803414 TGGACATTTATTAATGTTACCGG - Intronic
1014398978 6:120963782-120963804 TTATCTTTTATTAAAAATACTGG - Intergenic
1014549737 6:122776835-122776857 TTGACTTTTTCTAAAATTTCTGG + Intergenic
1014554070 6:122824504-122824526 TTGACCCTTATGAAGATTACAGG - Intergenic
1014560038 6:122878899-122878921 TTGCCCTTTATTGATATGACTGG - Intergenic
1014654404 6:124081932-124081954 CTGAGCTTTATTAAGATTGCAGG + Intronic
1015404408 6:132820986-132821008 TTGACCTTTCTGAAAATGCCTGG - Intergenic
1015923690 6:138289785-138289807 AAGACATTTATTAAAATAACAGG - Intronic
1016138029 6:140570789-140570811 TTGACCTTGTTTAAAATCTCAGG - Intergenic
1017408362 6:154143403-154143425 TCTACATTTATTAAAATTATTGG + Intronic
1017520894 6:155201353-155201375 TTCAACTTTATTAAAATTCTTGG + Intronic
1020215548 7:6187342-6187364 CTGTGCTTTATTAAAATCACTGG - Intronic
1020550582 7:9598695-9598717 TTGACATTTTTTAAGAGTACAGG - Intergenic
1020568280 7:9824543-9824565 TTTACTTTTATTTAAATTCCAGG + Intergenic
1020586134 7:10070733-10070755 TTGACCTTCATTAATAATAATGG + Intergenic
1021156231 7:17214267-17214289 TTTATCTTTATTAAAACTCCTGG + Intergenic
1021371566 7:19855100-19855122 AGGCCCTTTATTAAAATTATTGG + Intergenic
1021791668 7:24212096-24212118 TTAATATTTTTTAAAATTACAGG + Intergenic
1022147842 7:27564196-27564218 TTGTACTTTATGAAAATTAACGG - Intronic
1022361774 7:29666917-29666939 TTAACCTTTACAAAAAATACAGG - Intergenic
1022616350 7:31934742-31934764 CTGACCTTGAGTAAAATTTCTGG - Intronic
1022699618 7:32746808-32746830 TTAACCTTTACAAAAAATACAGG + Intergenic
1022793176 7:33709405-33709427 TTGACATCTATTAATATTTCAGG + Intergenic
1023685374 7:42728859-42728881 TTGTCCTTGATTAATATTACAGG + Intergenic
1023707036 7:42951953-42951975 TTGGCCATTATTAAAATTCCGGG + Intergenic
1024215200 7:47242779-47242801 TTGACATTTTTAAAAATTTCAGG + Intergenic
1024939517 7:54747278-54747300 TTGCCCTTTACAAAAATCACAGG + Intergenic
1025716957 7:63967238-63967260 TTGACTTTTATAAAATTTAATGG - Intergenic
1027717184 7:81687576-81687598 TAGAACTTTATTTGAATTACAGG - Intergenic
1027923233 7:84423353-84423375 TTGCCATTTCTTAAAAATACTGG + Intronic
1028064199 7:86361260-86361282 TTGATATTTATTGAAATTCCTGG - Intergenic
1031540364 7:122988019-122988041 TTGGCATTTACTAAAATTAAGGG - Intergenic
1031621940 7:123944875-123944897 TTTACTCTTAATAAAATTACAGG - Intronic
1032767392 7:135010360-135010382 TTGACACTTTTGAAAATTACAGG - Intronic
1033466887 7:141600189-141600211 TTGACATTGATTGAAAGTACTGG + Intronic
1034725803 7:153333959-153333981 TTAACCTTGATTCTAATTACTGG - Intergenic
1035014717 7:155755122-155755144 GTGAGCTTTATAAAGATTACAGG + Intronic
1036534704 8:9635792-9635814 CTGACATTTTTTAAAAATACAGG - Intronic
1037203655 8:16288161-16288183 TTGACCTTTAATACAATTATTGG - Intronic
1037262606 8:17025808-17025830 TTAACCTCTATTAAAATAAGAGG + Intergenic
1039937143 8:42054900-42054922 TTTACATTTAATATAATTACTGG + Intergenic
1041557567 8:59174757-59174779 TTGAAATTTGTTAAAATTTCTGG + Intergenic
1041744620 8:61194205-61194227 TTTACATTTAATAGAATTACTGG - Intronic
1041937678 8:63352154-63352176 TTAAGATTTATTAAAATTATTGG + Intergenic
1042242782 8:66681600-66681622 TTGACGTTTTATAAAAATACAGG + Intronic
1043010331 8:74872993-74873015 TTCAAATTTATTCAAATTACTGG - Intergenic
1044791117 8:95848112-95848134 TTGTCTTATAATAAAATTACTGG - Intergenic
1045610782 8:103838763-103838785 TTGCCATTTATTAAAGTTCCTGG + Intronic
1046234488 8:111404522-111404544 CTGACCTTTATACAAAATACTGG - Intergenic
1046991034 8:120453696-120453718 TTGATCTTTATGACAATTCCAGG - Intronic
1047061681 8:121234068-121234090 TTTATTTTTATTAAAATTACGGG + Intergenic
1047228737 8:122978148-122978170 TTGACCCAAATTAAAATTATAGG + Intergenic
1047576690 8:126163566-126163588 TTAACCATGATTAAAATTTCAGG - Intergenic
1050018563 9:1260803-1260825 TTCACCTTTAGTAAAATTAGAGG + Intergenic
1050808381 9:9713439-9713461 TTGTCCTTGATTACAATTAATGG + Intronic
1051284200 9:15478343-15478365 TTGATCTTTCTTAAAATTACAGG - Intronic
1051680010 9:19597590-19597612 GTCACCTCTATAAAAATTACAGG - Intronic
1051740722 9:20249220-20249242 TTGACCTTTAGTACAATGCCTGG + Intergenic
1052248812 9:26372508-26372530 TTTACCTTTAATAAGATTAGTGG - Intergenic
1052504335 9:29332747-29332769 TTCACCGTTCTTATAATTACGGG + Intergenic
1053316255 9:37054339-37054361 TTGACCCTTTGTAAAATGACAGG - Intergenic
1056040231 9:82658192-82658214 TTGGCCTTAATTAAAAATTCAGG - Intergenic
1058149398 9:101447382-101447404 TTCACTTTTATTATATTTACTGG + Intergenic
1060620310 9:125059281-125059303 TTGACATTTTTGAAGATTACAGG - Intronic
1186680196 X:11864914-11864936 TTGACCATTATTTAAATTGAGGG + Intergenic
1186719054 X:12282863-12282885 TTGACCTTTCTGGAAATTTCTGG - Intronic
1187799435 X:23044170-23044192 TTGCCTTTTATTAAAATAAATGG + Intergenic
1187892500 X:23949496-23949518 GTAACCTGTATTAAAATCACAGG + Intergenic
1188104833 X:26137381-26137403 TTAACCTTTATTTTAAGTACAGG - Intergenic
1188132482 X:26454058-26454080 TTGACATTTTTGAGAATTACAGG - Intergenic
1189773977 X:44453679-44453701 TGGGCCTATATTAAAATTCCTGG + Intergenic
1189794036 X:44630536-44630558 TGGAACTTTATGAAAATTAATGG + Intergenic
1190524844 X:51318475-51318497 TTCATCCTTATTAAAATTATTGG + Intergenic
1190545384 X:51520434-51520456 TTCATCCTTATTAAAATTATTGG - Intergenic
1193535563 X:82710942-82710964 TTCAGCTTTCTTAAAATTTCTGG - Intergenic
1193803547 X:85966717-85966739 TTATCCTTTCTTAAAATTAAAGG - Intronic
1194213248 X:91095174-91095196 TTGATGTTTTTAAAAATTACAGG + Intergenic
1194562549 X:95440343-95440365 TTGACATGTATTATAAATACTGG + Intergenic
1197137471 X:123079525-123079547 TTAACCTTTATTAAAGTAACTGG - Intergenic
1197298067 X:124743744-124743766 TTGATCTTTGTTACAATCACTGG + Intronic
1197742676 X:129907279-129907301 TCGACTTTTATTATAATTAAGGG + Intronic
1198659184 X:138948307-138948329 TTGACCTTTTTTAAAAAGATTGG + Intronic
1199315442 X:146372071-146372093 TTGAAATTTATTAAAATCTCTGG - Intergenic
1199431922 X:147771554-147771576 CTGGCCATTATTAAAATTCCAGG + Intergenic
1199516736 X:148685783-148685805 TTCATTTTTTTTAAAATTACCGG + Intronic
1201559325 Y:15299723-15299745 TTGACCATGATTTAAACTACAGG + Intergenic
1201791704 Y:17848333-17848355 CTTAGCTTTATTAACATTACTGG - Intergenic
1201809850 Y:18057656-18057678 CTTAGCTTTATTAACATTACTGG + Intergenic
1202191108 Y:22246219-22246241 TTAATCTTCATGAAAATTACTGG + Intergenic
1202353309 Y:24017988-24018010 CTTAGCTTTATTAACATTACTGG - Intergenic
1202517470 Y:25652127-25652149 CTTAGCTTTATTAACATTACTGG + Intergenic