ID: 1099362645

View in Genome Browser
Species Human (GRCh38)
Location 12:81724779-81724801
Sequence TGCAATAAACATAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099362640_1099362645 4 Left 1099362640 12:81724752-81724774 CCATATCTCTGCTATAGTGAATA 0: 1
1: 23
2: 710
3: 6289
4: 29554
Right 1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG 0: 1
1: 0
2: 3
3: 62
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099362645 Original CRISPR TGCAATAAACATAAGGGGGA AGG Intronic
902058916 1:13625218-13625240 TGGACTAAACAAAAGAGGGATGG - Intergenic
902183223 1:14705471-14705493 TGCAATAAACATGGGGGTGCAGG - Intronic
902266931 1:15274161-15274183 TGCAATAGGCAAAAGGCGGAAGG - Intronic
907599995 1:55759574-55759596 TGAAATGAAAAGAAGGGGGAAGG + Intergenic
909030876 1:70538111-70538133 TGCAATAAACATGAGAGTGCAGG + Intergenic
909415316 1:75399873-75399895 TGCAATAAACATATGAGTGCAGG - Intronic
909465306 1:75967239-75967261 TGCAATGAAGGTAAGGGGGTAGG - Intergenic
909593601 1:77379558-77379580 TGCAGGAAACGTAAGGGTGAAGG + Intronic
910452512 1:87361448-87361470 TGCAATGAACATATGTGTGAAGG - Intergenic
910673105 1:89792955-89792977 TGCAATGAACATGAGGGTGCAGG - Intronic
910721398 1:90290267-90290289 TGCTATAAACATGAGGGTGCAGG - Intergenic
911082509 1:93947328-93947350 TGCAATAAACATGGGGGTGCAGG + Intergenic
911779587 1:101859301-101859323 TGCAATAAATATTAGGGAGTGGG + Intronic
911798834 1:102108645-102108667 TGCAATAAACATACGTGTGCAGG + Intergenic
912005692 1:104897678-104897700 TGCAACAAACATGGGGGTGAGGG + Intergenic
912107409 1:106297181-106297203 TGCAGTAAATAGAAGAGGGATGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
915447324 1:155981384-155981406 AGCAGTAAACATCAGGGGGTGGG - Intronic
916141080 1:161698824-161698846 TGCAATAAACATATGTGTGCAGG - Intergenic
916301715 1:163282825-163282847 TGCAATAAACATGGGGGTGCAGG - Intronic
916573059 1:166043936-166043958 TGCAATAAACATATGAGTGCAGG - Intergenic
916617803 1:166460598-166460620 TGCAATAAACATGAGAGTGCAGG + Intergenic
916883131 1:169041719-169041741 TGCAATAAACATGAGAGTGCAGG - Intergenic
917065965 1:171093636-171093658 TGCGATAAACATATGGGTGCAGG + Intronic
917577439 1:176338760-176338782 TAGAATAAACACATGGGGGATGG + Intergenic
917841550 1:178984056-178984078 TGTAATAAACATAGGGGTGCAGG - Intergenic
919044454 1:192433269-192433291 TGCAATAAACATGAGGGTACAGG - Intergenic
919283625 1:195523944-195523966 TGCAATAAACATATGAGTGCAGG - Intergenic
919584993 1:199426235-199426257 TGCAATAAACATAAAAGTGCAGG - Intergenic
920606146 1:207388747-207388769 TGCAATAAACATAGGAGTGCAGG - Intergenic
920891543 1:209992043-209992065 TGCAATAAACATACAGGTGCAGG - Intronic
921435855 1:215120838-215120860 AGCAATAAACATACAGGGGATGG - Intronic
921994487 1:221403258-221403280 TGCAACAAACATAGGAGGGCAGG - Intergenic
922278979 1:224104548-224104570 TGCAATAAACATATGGGTTTAGG - Intergenic
922647167 1:227300357-227300379 TGCAATAAACATATGTGTGCAGG - Intronic
922773086 1:228199856-228199878 TGCAATAAACATGGGGGTGCAGG - Intergenic
922924886 1:229340601-229340623 TGCAAATAACAGAAGGTGGAGGG - Intronic
922982600 1:229840304-229840326 TGCAATAAACATATGAGTGCAGG - Intergenic
923001211 1:230007808-230007830 TGCAATAAACATACGAGTGTAGG - Intergenic
923426916 1:233879758-233879780 TGCAATGAACATATGGGTGCAGG + Intergenic
1065350583 10:24792222-24792244 TGCAATAAACATACGAGTGCAGG + Intergenic
1065394035 10:25215085-25215107 TACAATAGCCAAAAGGGGGAAGG + Intronic
1065518328 10:26546846-26546868 TGCAATAAACATGAGAGGGCAGG + Intronic
1065613198 10:27493108-27493130 TGCAATAAATACAAGAGTGAAGG + Intergenic
1065613628 10:27498329-27498351 TGCTATAAACATATGAGGGCAGG + Intergenic
1065700026 10:28415879-28415901 TGCAATAAACATATGAGTGTAGG + Intergenic
1065986357 10:30956836-30956858 TGCAATAAACATAGGAGGGCAGG + Intronic
1066384588 10:34931375-34931397 TGCAATAAAAATCAGGGAGAAGG - Intergenic
1066972605 10:42326545-42326567 TGCAATAAACATACGAGTGCAGG + Intergenic
1067535054 10:47102964-47102986 TGCCATCAAAATAAGGAGGAAGG + Intergenic
1067840663 10:49675808-49675830 TGCAATAAACATGAGAGTGCAGG - Intergenic
1068465116 10:57379837-57379859 TGCTATAAACATATGAGGGCAGG - Intergenic
1068641025 10:59408183-59408205 TGCAATAAACATGAGAGGGCAGG + Intergenic
1069354302 10:67565887-67565909 TGCAATAAACATACAAGTGAAGG - Intronic
1069355265 10:67577806-67577828 TGCAATAAACATACAAGTGAAGG + Intronic
1070468303 10:76748566-76748588 TGCAATGAACATATGGGTGCAGG - Intergenic
1071353779 10:84772669-84772691 TGCAATAAACATACGAGTGCGGG + Intergenic
1071372140 10:84963009-84963031 TAGAAAAAACAAAAGGGGGAAGG - Intergenic
1071501151 10:86205056-86205078 TGAAATAAAGATGAGGTGGATGG - Intronic
1072846030 10:98831410-98831432 TTCAATAAATATTGGGGGGAAGG - Intronic
1072872878 10:99138978-99139000 TGCAATAAACATATATGTGAAGG - Intronic
1073226174 10:101921524-101921546 TGCAGTAAACATAAGAGTGCAGG - Intronic
1073537388 10:104290123-104290145 TGCAACAAACATAAGGGTCCAGG - Intronic
1073813563 10:107178913-107178935 TGCAATAAACATGAGGGTTCAGG + Intergenic
1074933650 10:118156388-118156410 TGCAATAAACATATGAGTGCAGG - Intergenic
1075166578 10:120073337-120073359 TGTCATAAACACAAGGGTGAGGG - Intergenic
1078049672 11:7951907-7951929 TGCAATAAACATATGAGTGCAGG + Intergenic
1078222428 11:9363107-9363129 AGGAATAAATATATGGGGGAGGG - Intergenic
1078348364 11:10571793-10571815 TGCAATAAACATGAGGGTGCAGG + Intronic
1078694310 11:13614727-13614749 TGCAATAAACATATGAGTGAAGG + Intergenic
1078881919 11:15459805-15459827 TGCAATGAACATGAGAGGGCAGG + Intergenic
1080097219 11:28423393-28423415 TGCAATAAACATAGGGGTCCAGG - Intergenic
1080357410 11:31466443-31466465 TGCAATAAACATGAGGATGCAGG - Intronic
1081019647 11:37929647-37929669 TGAAATAAAGATACTGGGGAAGG + Intergenic
1081049617 11:38321898-38321920 TGCAATAAACATGAGAGTGCAGG - Intergenic
1081273282 11:41114362-41114384 TGGCATATACATAAGAGGGAAGG - Intronic
1085543139 11:77291060-77291082 TGCAATAAACATAGGGATGCAGG - Intronic
1085651325 11:78271465-78271487 TGAAATCAACATAAGGTTGAAGG - Intronic
1086310837 11:85534788-85534810 TGCAATAAACATATGAGTGCAGG + Intronic
1086658923 11:89390998-89391020 TGCTATAAAGAGATGGGGGAAGG + Intronic
1087662749 11:101006826-101006848 AGCAATAAAAATAAGGGAGGAGG - Intergenic
1087732978 11:101799337-101799359 TGCAATAAACATAGGGGTGCAGG - Intronic
1090338521 11:125993455-125993477 TGAAATAAACATAAAGGGTATGG + Intronic
1090537935 11:127665784-127665806 TGCACTAAACATGAGGAGTATGG + Intergenic
1091336424 11:134771603-134771625 TGCAATAAACATGGGGGTGCAGG - Intergenic
1091547650 12:1513532-1513554 TGCAATAAACATGTGAGTGAAGG - Intergenic
1092097701 12:5857323-5857345 TGCAATAAACATGGGGGTGCAGG + Intronic
1092925821 12:13271148-13271170 AACAATGAACATAAGAGGGAGGG - Intergenic
1093009991 12:14096555-14096577 TGCAATAAACATAAAAGTGTAGG + Intergenic
1093231712 12:16552944-16552966 TTCAATTATCATAAGTGGGAAGG - Intronic
1093681099 12:22004444-22004466 TGCAATAAACATGAGGACGCAGG + Intergenic
1093748172 12:22766856-22766878 TGCAATTAATATAAGGGAGTGGG - Intergenic
1094143938 12:27209331-27209353 TGCAATAAACATACAAGGGCAGG - Intergenic
1094384691 12:29881404-29881426 TGCAATAAACATATGGGTGCAGG + Intergenic
1095823972 12:46512189-46512211 CAAAATAAACATAAGGTGGAAGG - Intergenic
1096905584 12:54932390-54932412 TGCAATTGACATAAGGAGAAAGG + Intergenic
1098188024 12:67919265-67919287 TTCAATCAACTTAAAGGGGATGG + Intergenic
1098194006 12:67980149-67980171 TGCAATAAACAGAGGGGTGCAGG - Intergenic
1098201081 12:68056219-68056241 TGCAATAAACATACGAGTGCAGG + Intergenic
1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG + Intronic
1099484061 12:83206444-83206466 TGCAATAAACATACGAGTGCAGG - Intergenic
1099490086 12:83277998-83278020 TGCAAAAAAAAAAATGGGGACGG - Intergenic
1099506756 12:83487112-83487134 TGCAATAAACATGGGGGTGCAGG + Intergenic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100188376 12:92162416-92162438 TACAATAAACATATGAGTGAAGG + Intergenic
1100400767 12:94227074-94227096 TGCAACAAACATAAAAGAGAAGG - Intronic
1100554354 12:95677878-95677900 TGCAATAAACATACGTGTGCAGG - Intronic
1102106819 12:110332052-110332074 CACAATAAAAATAAGTGGGAAGG + Intronic
1102604986 12:114061481-114061503 TGGAATTAACATAAGGAGAAAGG - Intergenic
1103245093 12:119449970-119449992 TGCAATAAACATATGAGTGAAGG - Intronic
1105609848 13:21958715-21958737 TGCAATAAACATACTGGTGCAGG + Intergenic
1105877129 13:24566884-24566906 AGCAATAAACATAGGAGGTAGGG + Intergenic
1106235511 13:27857365-27857387 TTAAATAATAATAAGGGGGAAGG - Intergenic
1106352392 13:28945273-28945295 TATAATAAACATACGAGGGAAGG + Intronic
1106477308 13:30109427-30109449 TGCAGGGAACATAAGGAGGAGGG + Intergenic
1109035222 13:57249784-57249806 TGCAATAAATATATGGGTGCAGG - Intergenic
1109391386 13:61698274-61698296 TGCAATTAACATAAGAGTGCGGG - Intergenic
1109636362 13:65123136-65123158 TGCAATTAACATATGGGTGCTGG - Intergenic
1110001351 13:70206207-70206229 TGCAGTAAAAATAAGGAAGAGGG + Intergenic
1110175224 13:72548331-72548353 TGCAATAAACATATGGGTGCAGG - Intergenic
1110182031 13:72628284-72628306 TCCAATAAACTTAAGGTGAAGGG + Intergenic
1110236117 13:73219845-73219867 AGCTATGAACATAAGGGAGAAGG - Intergenic
1110754766 13:79159648-79159670 TGCAATAAACATGAGGGTGCAGG + Intergenic
1111161102 13:84395813-84395835 TGCAATAAACATAAGGGTATTGG - Intergenic
1111379911 13:87435738-87435760 TGCAATAAACATATGCGTGCAGG - Intergenic
1111396556 13:87674130-87674152 AGCAAGAAAAAAAAGGGGGAGGG + Intronic
1112137395 13:96596411-96596433 TGCAATAAACATATGCAGGCAGG + Intronic
1112982902 13:105408737-105408759 CGCAATAAACATAAGTGTGCAGG + Intergenic
1113278522 13:108762293-108762315 TGCAATAAACACATGAGGGCAGG + Intronic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1114797813 14:25736866-25736888 TTCAATAAACATAAGGGTACAGG - Intergenic
1114994835 14:28335789-28335811 TGCAATAAACATATGTGTGCAGG - Intergenic
1115377975 14:32699631-32699653 AGCAAGACAGATAAGGGGGAAGG - Intronic
1115486139 14:33913238-33913260 TGCAATAAACATGGGGGTGCAGG + Intergenic
1116002726 14:39261438-39261460 TGCAATAAACATACGTGTGCAGG + Intronic
1116436344 14:44898224-44898246 TGCAATAAAAATGAGGGGTGGGG - Intronic
1116473413 14:45311561-45311583 TGCAATAAACATAGGGGTGCAGG + Intergenic
1116790259 14:49332363-49332385 TGCAATAAACATATGAGTGCAGG - Intergenic
1116831570 14:49725300-49725322 TGTAATAAACTTTAGGGGGTGGG - Intronic
1117856034 14:60034796-60034818 TGCAATAAACATAGGAGTGCAGG + Intronic
1118033608 14:61841967-61841989 TGCAATAAACATATGAGTGCAGG + Intergenic
1118133300 14:62992276-62992298 TGCAATAAACATATGAGTGCAGG + Intronic
1120745846 14:88150817-88150839 TGCAATAAACATATGAGTGCAGG + Intergenic
1121487946 14:94333223-94333245 TGCAATGAACATGAAAGGGAAGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122944552 14:105000938-105000960 TGCAATAAACATGGGGGTGCGGG - Intronic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1124833286 15:33170934-33170956 TGCAGTAAACATGAGGGTGCAGG - Intronic
1124938470 15:34195137-34195159 TGCAATAAACATATGAGTGCAGG - Intronic
1125145367 15:36461230-36461252 TGCAATAAACACATGTGTGAAGG + Intergenic
1125282562 15:38058235-38058257 TTCATAAAACATAAGGGGCATGG - Intergenic
1126610046 15:50519970-50519992 TGCAATAAACATGAGGGTGCAGG - Intronic
1126659501 15:51018464-51018486 TGCAATAAACATGAGGGTGCAGG + Intergenic
1126979210 15:54222542-54222564 TGCAATAAACATGAGAGAGCAGG + Intronic
1127663118 15:61119068-61119090 TGCAGTTAACAGAAGGGGGGGGG + Intronic
1130726396 15:86443903-86443925 TGCAATAAACATAAGGGTGCAGG + Intronic
1130967414 15:88707608-88707630 TGCAATAAACATATGTGTGCAGG + Intergenic
1131005620 15:88975300-88975322 TGCAATAAATATGAGGGTGCAGG + Intergenic
1131350605 15:91696386-91696408 TTGAATTAACATAAGGGGTAGGG - Intergenic
1131454825 15:92575400-92575422 AGCAATAGACAGAAGGAGGAAGG + Intergenic
1131626780 15:94128801-94128823 TGCAATAAACATATGAGAGCAGG + Intergenic
1131804862 15:96110610-96110632 TTCAAAAAACATCAGGCGGAGGG - Intergenic
1134022113 16:10928590-10928612 TTCATTAAAGATAGGGGGGAAGG - Exonic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1134781607 16:16903075-16903097 TGCAATAAACATGAGGGTGGAGG + Intergenic
1135613300 16:23887646-23887668 TGCAATAAACATGAGAGTGAAGG + Intronic
1136668962 16:31839012-31839034 TGCAATAAACATATAAGGGCAGG - Intergenic
1137026765 16:35484674-35484696 TGCAATAAACATATGAGTGTGGG - Intergenic
1137032910 16:35541699-35541721 TGCAATAAACATATGAGTGTGGG - Intergenic
1138339425 16:56279041-56279063 TGAAAAAAACATGAGAGGGAAGG - Intronic
1138354906 16:56369703-56369725 TGCAATAAACATATGAGCGCAGG - Intronic
1138498125 16:57420948-57420970 TGCAATAAACATGGGGGTGCAGG - Intergenic
1138637600 16:58353737-58353759 TGCAATAAACATGAGGGTGCAGG + Intronic
1138721165 16:59082076-59082098 TGCAATAAACATATGAGTGGAGG - Intergenic
1139483147 16:67241730-67241752 TGCTATAAAGATAAACGGGAAGG + Intronic
1140232568 16:73129911-73129933 TGCCTTAAACACAAGGAGGATGG - Intronic
1144080550 17:11760198-11760220 TGCAATAAACATAAGAGTGCAGG + Intronic
1144121500 17:12158357-12158379 TGCAATAAACATGAGAGTGCAGG + Intergenic
1144404513 17:14939840-14939862 GGCAATAAGCAGAAGGGGGCTGG - Intergenic
1146983706 17:37191476-37191498 TGCACTAAAAGTAAGGAGGAAGG - Intronic
1147519222 17:41153304-41153326 TGCAATAAACATATGTGTGCAGG + Intergenic
1148562467 17:48613799-48613821 TGCCATAAACTTTAGGAGGAAGG + Intronic
1149061537 17:52428351-52428373 TGCAATAAACATAGGAGTGCAGG - Intergenic
1149117167 17:53111399-53111421 TGCAAGAAAAATAAGTGGAAGGG - Intergenic
1149125312 17:53223275-53223297 TACAATAAACATATGGGTGCAGG - Intergenic
1149205749 17:54244595-54244617 TAAAATGAACATAATGGGGAGGG + Intergenic
1149457459 17:56799526-56799548 TGCTATAAACATCTGGGGGCAGG + Intronic
1149487323 17:57052928-57052950 CGCAATAAAAAAATGGGGGAGGG + Intergenic
1150873025 17:68935642-68935664 TGCAATAAACATATGAGTGCAGG + Intronic
1153016616 18:588147-588169 TGCAATAAACATGGGGGTGCAGG + Intergenic
1153148733 18:2065136-2065158 TGCAATAAACATAGGAGTGCAGG - Intergenic
1153704413 18:7730872-7730894 TGCAATTATGATAAAGGGGAAGG - Intronic
1153929853 18:9868414-9868436 TGCAATAAACATAGGTGTGTGGG + Intergenic
1155456262 18:26017786-26017808 TGCTATAAAGATAAAGGTGAGGG - Exonic
1155786453 18:29908370-29908392 TGTAATAACCTTAAGGGTGAAGG + Intergenic
1156060572 18:33070217-33070239 TGCAATAAACATGCGGGTGCAGG - Intronic
1156330216 18:36114477-36114499 AGGAATAAACATAAAGGGCATGG + Intronic
1156429322 18:37054353-37054375 TGCAATAAACATATGAGTGCAGG - Intronic
1156779387 18:40833033-40833055 TGCAATAAACATAAGACTGCAGG - Intergenic
1156887162 18:42148783-42148805 TGCAATAAACATACGTGTGCAGG + Intergenic
1156892571 18:42206669-42206691 TGCAATAAACATACGTGTGCAGG + Intergenic
1156960642 18:43025472-43025494 TGCAATAAACATACAGGTGTAGG - Intronic
1158736036 18:60080964-60080986 TGCAATAAACACAGGGAGGCAGG - Intergenic
1158997196 18:62934263-62934285 TGCAATAAACATATGAGTGCAGG - Intronic
1159116651 18:64121642-64121664 TGCAATAAACATACGGGCACAGG + Intergenic
1159482849 18:69013061-69013083 TGTAATAAACATACAGGGGCAGG - Intronic
1159556566 18:69951966-69951988 TGCAATAAACATATAAGGGCAGG - Intronic
1163005495 19:14394561-14394583 TGCATAAAACAAAAGGGGGCTGG + Intronic
1163458836 19:17424483-17424505 AACAAGAAAAATAAGGGGGAGGG + Intronic
1164894867 19:31865603-31865625 TGCAATGAACACAATGGGCATGG - Intergenic
1165983289 19:39744974-39744996 TGCAATAAACATAAGAGTTAAGG - Intergenic
1166247750 19:41542230-41542252 TGTAATAAAAATAAGGTTGATGG + Intergenic
1168180163 19:54656871-54656893 TGCAATAAACACACGGGTGCAGG + Intronic
1168198441 19:54794105-54794127 TGCAATAAACATACAGGTGCAGG + Intronic
925721017 2:6827248-6827270 TGCATTAAAAATAAGGGTTAGGG - Intergenic
925764285 2:7215668-7215690 TGCAATAAGCATCTGGGGAAGGG + Intergenic
927130782 2:20057610-20057632 TGCAATGAACATGAGGGTGCAGG - Intergenic
928717926 2:34084452-34084474 TGCAATAAACATAGGGAGTGTGG + Intergenic
929272930 2:39993529-39993551 TGCAATAAACATGGGAGGGCAGG - Intergenic
929970591 2:46571520-46571542 TGCAATAAATAAAGGAGGGAAGG - Intronic
930212639 2:48657552-48657574 TTCAATAAACATAAGAGTGCAGG + Intronic
931139398 2:59440253-59440275 ATCCATAAACATAAGTGGGAGGG - Intergenic
932945213 2:76221846-76221868 TGGAATAAAAATGAGGGGTAAGG + Intergenic
933031898 2:77338791-77338813 TGCAATAAACATACGAGTGCAGG - Intronic
933175868 2:79172339-79172361 TGCAATAAACATGGGAGGGCAGG - Intergenic
933248504 2:80002552-80002574 TGCAATAAAAAGGAGAGGGAGGG + Intronic
934487206 2:94726271-94726293 TGCTATAAACATGAGGGTGCAGG + Intergenic
934813723 2:97306313-97306335 TGCCATAAACATAAGAAGCAGGG - Intergenic
934823972 2:97402167-97402189 TGCCATAAACATAAGAAGCAGGG + Intergenic
934911325 2:98257410-98257432 TGCAATAAACATGAGGGTGCAGG + Intronic
935500026 2:103827756-103827778 TGCCTTAAAAATGAGGGGGAGGG - Intergenic
936261657 2:110965274-110965296 TGCAATAAACATGTGGGTGCAGG + Intronic
936603233 2:113920919-113920941 TGCAATAAACATGAGGGTGCAGG + Intronic
936785464 2:116089197-116089219 TGCAATAAACATAAGGCTGCAGG + Intergenic
937944197 2:127316546-127316568 TGCTAAAAACATTAGGTGGATGG + Intronic
938524399 2:132113776-132113798 TGCAATAAACATACGAGTGCAGG - Intergenic
938693886 2:133817384-133817406 TACAATAAACATGAGGGTGCAGG - Intergenic
938917154 2:135953696-135953718 TGCTCTAAAAATAAGGGGGAGGG - Intronic
939376113 2:141370093-141370115 TGCAATAAACATATGAGTGCAGG + Intronic
939998529 2:148943320-148943342 TGCAATGAACATACTGAGGAAGG - Intronic
941539572 2:166765862-166765884 TGCAATAAAATTATGTGGGAAGG + Intergenic
943469605 2:188277181-188277203 TGTAATTTATATAAGGGGGAAGG - Intergenic
944345002 2:198652735-198652757 AGAAATAAACAAAAAGGGGAGGG + Intergenic
945400373 2:209374694-209374716 TGCAATAAACATACGTGTGCAGG - Intergenic
945576168 2:211531849-211531871 TGCAATAAACATAGGAGTGCAGG - Intronic
945619034 2:212110311-212110333 AGCAATAAATATACTGGGGACGG - Intronic
945712647 2:213318194-213318216 TGCAATAAACGTAAGAGTGTGGG - Intronic
946641752 2:221791249-221791271 TGCAATAAACATGGGGGTGCAGG - Intergenic
947040573 2:225914247-225914269 TGCAATAAACATGAGAGTGAAGG + Intergenic
947921111 2:233875187-233875209 TGCAGTAAACATTAGTGGGAAGG - Intergenic
948136881 2:235643058-235643080 TGCAATAGAAAAAAGGGGGAAGG - Intronic
948511263 2:238466713-238466735 AGCAACAAACATTTGGGGGAAGG + Intergenic
1169412908 20:5388827-5388849 TGCAATAAACATGGGGGTGTAGG - Intergenic
1169598052 20:7223286-7223308 TGCAATAAACATGAGGGTGCAGG + Intergenic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1169869837 20:10238512-10238534 GGCAAAAAATATAAGGGGAATGG + Intronic
1170886584 20:20344792-20344814 TGCAATAAACATGAGTGTGTAGG - Intronic
1171042093 20:21774258-21774280 TGCAATAAACATACGAGTGCAGG + Intergenic
1171188116 20:23137712-23137734 CGCAAGAAGCCTAAGGGGGAAGG + Intergenic
1171357375 20:24559024-24559046 TGCAATAAACATATGAGAGCAGG - Intronic
1171916997 20:31068968-31068990 TGGAATAAACAAAAGTGGTATGG + Intergenic
1172145191 20:32752606-32752628 TGAGATAAACATAGAGGGGATGG - Intergenic
1173110034 20:40178213-40178235 TGTAATAAACATAGGGGTGCAGG - Intergenic
1173171757 20:40731519-40731541 TATAATAAAAAAAAGGGGGAGGG - Intergenic
1174009218 20:47436137-47436159 AGAAATAAAAATAAAGGGGAAGG - Intergenic
1174225099 20:48992061-48992083 TGCAAGAAAAATAAGGGAGGAGG + Intronic
1174953758 20:55072978-55073000 TGCAATAAACATGGGGGTGTAGG + Intergenic
1175446099 20:59020597-59020619 TACAATAAACATGAGAGGGGAGG - Intronic
1176250044 20:64116295-64116317 TCCCATAAACACAAGGCGGATGG - Intergenic
1176838005 21:13812161-13812183 TGCTATAAACATGAGGGTGCTGG + Intergenic
1177101841 21:16907627-16907649 TGCAATAAACATGGGGGTGCAGG - Intergenic
1177256682 21:18672268-18672290 TGCAATAAACATAGGCGTGCAGG - Intergenic
1177417904 21:20818030-20818052 TGCAATAAACATATGAGTGCAGG + Intergenic
1177499586 21:21935756-21935778 TGCAATAAACATAAAAGTGCAGG - Intergenic
1177677993 21:24327648-24327670 TGCAATAAACGTAGGGGTGCAGG + Intergenic
1178868571 21:36351877-36351899 TGCAATAAACATGAGAGTGCAGG - Intronic
1179272152 21:39859904-39859926 TGCAATAATCATAAAAGGGCAGG - Intergenic
1179400963 21:41082903-41082925 TGCAATAAACATATGAGTGCAGG + Intergenic
1179946369 21:44680580-44680602 TGCAATAAACATGGGGGTGCAGG - Intronic
1180032163 21:45219676-45219698 TGCAACCACCATAAGGTGGATGG + Intronic
1180123792 21:45772513-45772535 TGCAATAAACATAGGAGTGCAGG + Intronic
1180519259 22:16180513-16180535 TGCAATAAACATATGAGTGCAGG + Intergenic
1182755973 22:32679428-32679450 TGCAATGAACATGAGAGTGAAGG + Intronic
1182933802 22:34200903-34200925 TGTAATAAAGAGAAGGGGAATGG - Intergenic
1183972433 22:41487842-41487864 TGCTATAAACGAAATGGGGAAGG - Intronic
1184881626 22:47308462-47308484 TGCAATAACCATAAAGGAAAAGG - Intergenic
950213934 3:11144242-11144264 TGCAATAAACATACGCGTGCAGG - Intronic
951030178 3:17872790-17872812 TACAATAAACATAAGAATGAAGG + Intronic
951296490 3:20942440-20942462 TGGAATATAGAAAAGGGGGAGGG + Intergenic
951358508 3:21698139-21698161 TGCAATAAACATATGTGTGCAGG - Intronic
952244252 3:31568311-31568333 TGCAATAAACATGAGAGTGCAGG + Intronic
952253356 3:31675110-31675132 TGCAGTAGACATCAGGGGCAAGG - Intronic
954507178 3:51087940-51087962 TGCAATAAACACAAGGGTGCTGG - Intronic
954605061 3:51903091-51903113 TGCAATCAGCATTAGGGGAAAGG + Intronic
956183705 3:66542884-66542906 TGCAATAAACACAAAGGTGCAGG + Intergenic
956188967 3:66590189-66590211 TGCAATAAACATAGGGGTGCAGG + Intergenic
956547643 3:70423007-70423029 TGTAAAAAACATTAGGGGCAGGG + Intergenic
957221072 3:77382868-77382890 TGCAATAAACATATGTGTGCAGG + Intronic
957259143 3:77877711-77877733 CGCAATAAACATAAGTGGCATGG + Intergenic
957492339 3:80944614-80944636 TGCAGCAAACATAAGGGTGCAGG + Intergenic
957881638 3:86221709-86221731 TGCATTTAAAATAAGGGAGAGGG - Intergenic
958058842 3:88450801-88450823 TGCAATGAACATAAGCAGGTAGG + Intergenic
958588812 3:96126408-96126430 TGCAATAAACATAAGAAGGCAGG - Intergenic
958589273 3:96134183-96134205 TGCAATAAACATGGGGGAGTAGG + Intergenic
958686191 3:97399392-97399414 TGCAATAAACATGATGTGGGGGG + Intronic
958694062 3:97505637-97505659 TGCAATAAACATATGTGTGCAGG + Intronic
959258011 3:104039104-104039126 TGCAATAAACATATGAGGGTAGG - Intergenic
959259106 3:104052239-104052261 TGCAAGAAACATACAGGCGAAGG - Intergenic
959890423 3:111549120-111549142 GGAAATGAAAATAAGGGGGAAGG - Intronic
960034411 3:113088046-113088068 AGAAATGAAGATAAGGGGGAAGG + Intergenic
961996127 3:131245397-131245419 TGCAATAAACATAAAAGTGCAGG + Intronic
962429982 3:135310173-135310195 TGCAATAAACATAGGAGTGCAGG + Intergenic
962684636 3:137835478-137835500 TGCAATAAAAAAAAGGGGGGTGG + Intergenic
965005045 3:163010449-163010471 TGCAACAAACATAAGAGTGCAGG - Intergenic
965490793 3:169333417-169333439 CACAATAAACATTAGGGAGATGG + Intronic
966288722 3:178329216-178329238 TGCAAAAAAATAAAGGGGGATGG + Intergenic
966499329 3:180621215-180621237 TGCAATAAACATAGGAGTGGAGG + Intronic
967454735 3:189671579-189671601 TGCAATAAATATAAAGGTGCAGG - Intronic
968191836 3:196673948-196673970 TGCAATAAACATGGGAGGGCAGG + Intronic
968256685 3:197280441-197280463 TGCAATAAACATGGGGGTGCAGG + Intronic
968885389 4:3327931-3327953 TGCAATAAACAGAAGAGTGCAGG - Intronic
969909573 4:10431157-10431179 TGCAATAAACATAGGGGTGCAGG + Intergenic
970011309 4:11462549-11462571 TGCAATAAACATAAGAGTGAAGG - Intergenic
970169021 4:13270274-13270296 TGCAATAAATATATGAGGGCAGG + Intergenic
971512749 4:27447333-27447355 CGCAATAATCATAAGGGAAATGG - Intergenic
972395214 4:38653118-38653140 TGCACTAAAGATAAGGGAAATGG - Intergenic
972784345 4:42313163-42313185 TGCAATAAACATTTGTGTGAGGG + Intergenic
972912812 4:43839092-43839114 TGAAATAAACATAGGGGTGCAGG - Intergenic
973350841 4:49101084-49101106 TGGAATAAACCTGAGTGGGACGG - Intergenic
973351752 4:49106832-49106854 TGGAATAAACCTGAGTGGGACGG - Intergenic
973403162 4:49651019-49651041 TGGAATAAACATGAGTGGAATGG + Intergenic
975759426 4:77604340-77604362 TGCGATAGACAGAAGGAGGAAGG - Intronic
976138569 4:81965333-81965355 TGCAATAAACATGGGGGTGCAGG + Intronic
976325697 4:83769348-83769370 AGAAATACACAGAAGGGGGAAGG - Intergenic
976335823 4:83884984-83885006 TGCAATAATCAAAAGGAGGGTGG - Intergenic
976931480 4:90571271-90571293 TGCAATAAACATATGAGTGAAGG - Intronic
977009448 4:91618274-91618296 TGCAATAAACATGTGGGTGCAGG - Intergenic
977308941 4:95360494-95360516 TGCAAAAAACATACAGGGAAAGG + Intronic
978033819 4:103971011-103971033 TGCAACACAGAAAAGGGGGAGGG - Intergenic
978284495 4:107060034-107060056 AGCATTAAATTTAAGGGGGATGG + Intronic
978351254 4:107823231-107823253 TGCAATAAACATAGGAGTGCAGG + Intergenic
978369351 4:108015080-108015102 TGCAATAAACATATGAGTGCAGG + Intronic
978839998 4:113200777-113200799 TGCAATAAACATAAGGGTGCAGG + Intronic
978893645 4:113858562-113858584 TGCAATAAACATAGGTGTGCAGG + Intergenic
979156447 4:117397313-117397335 TGCAATAAACATATGAGTGCAGG + Intergenic
979914551 4:126414044-126414066 TGCAATAAACATATGTGTGCAGG - Intergenic
980287561 4:130799892-130799914 TGCAATAAACATAGGAGTGAAGG + Intergenic
980633426 4:135468429-135468451 TGCAATAAACATACGTGTGCAGG + Intergenic
981142578 4:141286637-141286659 TGCAATAAACATGAGGGTGCAGG + Intergenic
981457274 4:144967648-144967670 TATCATAAACATAAGGGGTAGGG + Intronic
982762655 4:159305129-159305151 TGCAATAAACATACAGGTGCAGG + Intronic
983799802 4:171912994-171913016 TGCAATAAACATGTGGGTGCAGG + Intronic
984148813 4:176100033-176100055 TGCAATAAACATATGAGTGCAGG + Intronic
984836797 4:184029857-184029879 TACAATAAACAGAAGGGGCTGGG + Intergenic
985513862 5:327671-327693 TGCAATAAACATATGAGTGCAGG + Intronic
985974391 5:3404547-3404569 TGCAATGAACAGAATGAGGAAGG - Intergenic
986030388 5:3887973-3887995 TGTAATAAATATAAGGTGGCCGG - Intergenic
986227872 5:5833758-5833780 TGCAATAAACATACGTGTGCAGG - Intergenic
987135970 5:14899712-14899734 TGCAATAAAAAAAAAGGGGCTGG + Intergenic
987734399 5:21821256-21821278 TGCAATAAACAAAAAAAGGAAGG - Intronic
988698843 5:33652076-33652098 TGCAATAAACATACGAGTGCAGG + Intronic
989204654 5:38798589-38798611 TGCATTAAACAATAGGGCGAAGG + Intergenic
989314675 5:40063982-40064004 TGCAATAAACATATGAGTGCAGG + Intergenic
989669887 5:43904149-43904171 TGGAATAAAGATAAAGGGAAAGG + Intergenic
990770008 5:59232716-59232738 TGCAATAAACATAGGGGTTCAGG - Intronic
990777502 5:59318943-59318965 TGCAATGAACAGAAGGGCTATGG - Intronic
990783157 5:59389639-59389661 TGCAATAAACATGGGGGTGCAGG - Intronic
991013433 5:61907846-61907868 TGCAATAAACATATGTGTGCAGG - Intergenic
991077117 5:62553438-62553460 TGTAATAAACATGAGGGAGCAGG + Intronic
991606378 5:68405776-68405798 TACAATCAAAATGAGGGGGATGG - Intergenic
992257896 5:74940272-74940294 TGCAATAAACATATGAGTGCAGG - Intergenic
993986040 5:94598922-94598944 TGCAATAAACATGGGGGTGAAGG + Intronic
994130560 5:96222803-96222825 TGCAATAAACATAGGGGTGCAGG - Intergenic
994548258 5:101198036-101198058 TGCAATAAACATATGTGTGCAGG + Intergenic
996890673 5:128415655-128415677 TGCTATAAACATGAGGGTGCAGG + Intronic
998662492 5:144255270-144255292 TGCAATAAACATAGGAGTGCAGG + Intronic
999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG + Intergenic
999661322 5:153866206-153866228 TTCAATGGACATAAAGGGGAGGG + Intergenic
1000032481 5:157416144-157416166 TGCAATAAATATGAGAGGGCAGG - Intronic
1000203231 5:159032366-159032388 TGCAATAAATATAATGGAAAGGG - Intronic
1000496344 5:161989665-161989687 TGATAAAAACATAAGGGAGACGG - Intergenic
1001220361 5:169895298-169895320 TGCAAGAAACAAGAGAGGGAAGG - Intronic
1001750185 5:174123395-174123417 TGCAATAAACATATGTGTGCAGG + Intronic
1002996903 6:2294988-2295010 TGCAATAAACATATGTGTGCAGG - Intergenic
1004139555 6:13004069-13004091 TGTAATAAACATATGGGTGCAGG + Intronic
1004338431 6:14785178-14785200 TGCTTTAAACAAATGGGGGAAGG + Intergenic
1004776684 6:18854276-18854298 TGCAATAAACATATGAGTGCGGG + Intergenic
1005183371 6:23133713-23133735 TGCAATAAAAATGATGGTGAAGG + Intergenic
1005469429 6:26147508-26147530 TTCATTTAATATAAGGGGGATGG + Intergenic
1006211572 6:32400206-32400228 GGCCATAAACATAAAGGGAAGGG - Intronic
1007289058 6:40770814-40770836 TGCAATAAACATACAAGTGAAGG + Intergenic
1008239499 6:49091831-49091853 TGCAATAAACATGAGGGTACAGG + Intergenic
1008304075 6:49879511-49879533 TGCAATAAACATGAGAGTGGAGG + Intergenic
1008712659 6:54247554-54247576 GGCATTAAACATAAAGGAGATGG + Intronic
1009504954 6:64466292-64466314 TGCAATAAACATGGGGGTGCAGG - Intronic
1009629699 6:66179484-66179506 TGCATTGAACATAAGTTGGAAGG + Intergenic
1009670669 6:66745204-66745226 TGCAATAAACATGGGGGTGCAGG + Intergenic
1010618759 6:78046900-78046922 TGCAATAAACATATAAGGGCAGG + Intergenic
1010807217 6:80251561-80251583 TACAATAAACATATGGCAGAAGG - Intronic
1011114371 6:83874189-83874211 TTCAAAAAAAATAAGAGGGAAGG - Intronic
1011568970 6:88713427-88713449 TGCATTTAAACTAAGGGGGAAGG + Intronic
1011932188 6:92727696-92727718 TGCATTCAACATAAGAGGAAAGG + Intergenic
1011992174 6:93535657-93535679 TGCAATAAACATATGAGTGCAGG + Intergenic
1012179105 6:96128666-96128688 TGCAATAAACATTTTGGTGAAGG - Intronic
1012502990 6:99910828-99910850 TGCAATAAACATTAGAGTGCAGG + Intergenic
1012830470 6:104198428-104198450 TGCAATAAACATATGCGAGCAGG - Intergenic
1013568419 6:111394081-111394103 TGCAATAAACATGGGGGTGTAGG + Intronic
1013905483 6:115212270-115212292 TGCAATAAACATATGAGTGCAGG - Intergenic
1014018349 6:116560734-116560756 TCCATTAAGCATAAAGGGGAGGG - Intergenic
1014073379 6:117208793-117208815 TGCAATAAACATGAGAGTGCAGG + Intergenic
1014330779 6:120060864-120060886 TGCAATAAACATGTGAGGGCAGG - Intergenic
1014629171 6:123768493-123768515 AGCAAGAAAAATAAGAGGGAAGG - Intergenic
1014862924 6:126492600-126492622 TGCAATAAACATGGGGGTGCCGG + Intergenic
1015057317 6:128919657-128919679 TACAACAAACAAATGGGGGAGGG - Intronic
1015488916 6:133802821-133802843 TACAATAAACATAGGAGTGAAGG + Intergenic
1015594643 6:134854766-134854788 TGCAATAAACATGGGGGTGCAGG + Intergenic
1017216001 6:151908101-151908123 TGTTAAAAACATAAGGGGAAAGG - Intronic
1017361673 6:153579702-153579724 TGCAATAAACCTGGGGGTGAAGG - Intergenic
1017591624 6:155984358-155984380 TGAAATAAAAAGAAGGGAGATGG + Intergenic
1017650223 6:156574205-156574227 TGCAATAAACATGGGGGTGCAGG + Intergenic
1018325372 6:162662066-162662088 TGCAATAAACATATGAATGAAGG + Intronic
1018366560 6:163126389-163126411 TGAAATGAACAGAAGTGGGAAGG - Intronic
1018477242 6:164155703-164155725 TGCAATAAACATATGAGTGCAGG - Intergenic
1019788487 7:2994865-2994887 TGCCATGAACATAAGGGCGTGGG - Intronic
1020673115 7:11144406-11144428 TGCAATAAACATGGGGGTGCAGG - Intronic
1021135337 7:16958361-16958383 TGCAATAAACATACGTGTGCAGG + Intergenic
1021137391 7:16982122-16982144 TGCAATAAACATATGAGTGTAGG + Intergenic
1021187993 7:17587800-17587822 TGCAATAAACATATGGGTGCAGG - Intergenic
1021367406 7:19796855-19796877 TGCAATAAGCATGAGGGTGCAGG + Intergenic
1021491382 7:21222925-21222947 TGCAATAAACATATGAGTGTAGG + Intergenic
1021858577 7:24882546-24882568 TGCAATAAACATATGAGTGCAGG + Intronic
1021905062 7:25324990-25325012 TGCAATAAACATACGTGTGCAGG + Intergenic
1021996599 7:26184079-26184101 TGCAATAAACATGGGGGTGCAGG - Intronic
1022163344 7:27733434-27733456 TGCAACAAACCTATGGGTGAGGG + Intergenic
1023409508 7:39875462-39875484 TGCAATAAACATGGGGGTGCTGG + Intergenic
1024520589 7:50302431-50302453 GGCAATAAACATAAGGTACAAGG - Intergenic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1024915861 7:54499179-54499201 TGCAATAAACATACGTGTGCAGG + Intergenic
1025043424 7:55668559-55668581 TGCAATAAACATGGGGGTGCTGG - Intergenic
1027341577 7:77213917-77213939 TGCAATAAATATAAGAGTGCAGG + Intronic
1027344845 7:77247973-77247995 TGCAATAAACATATGAGCGCAGG - Intronic
1027732593 7:81894864-81894886 TGCTATAAACATACGGGTGCAGG + Intergenic
1028352964 7:89871724-89871746 TGCAATAAACATAGGAGTGCAGG + Intergenic
1028434315 7:90783965-90783987 TGCAATAAACATGGGGGTGCAGG - Intronic
1028455070 7:91029638-91029660 TGCAGGAAACAGAAGGGGAAGGG - Intronic
1029286771 7:99471157-99471179 TGCAATAAACATATGTGTGTTGG - Intergenic
1031801100 7:126246925-126246947 TGCAATAAACATGCGGGTGCAGG + Intergenic
1032395888 7:131589658-131589680 TGCAATAAACATATGAGTGCAGG - Intergenic
1033413001 7:141137253-141137275 TGCAATACACATAGGGGTGCAGG - Intronic
1033877076 7:145834732-145834754 TGCAATAAACATGAGAGTGCAGG + Intergenic
1034683515 7:152949413-152949435 TGCAATAAACACACGGGTGCAGG + Intergenic
1034687198 7:152983050-152983072 TGCAATAAACATGGGGGTGCAGG - Intergenic
1034742162 7:153485752-153485774 TGCAATAAACATGAGGGTGCAGG - Intergenic
1034755309 7:153612103-153612125 TGCAATGAACATAAGAGTGCAGG - Intergenic
1035835598 8:2748440-2748462 TGCAATAAACATAGGAGGCCAGG - Intergenic
1036154300 8:6327536-6327558 TGGAATAAACAGATGGGGGAAGG - Intergenic
1036161162 8:6389786-6389808 TGTAAAAAAGATAAGGGGAAAGG - Intergenic
1038324845 8:26565232-26565254 TGCAATAAACATAGGAGTGCAGG + Intronic
1039362045 8:36887096-36887118 TGCAATAAACATATGTGTGCAGG + Intronic
1039617415 8:38967240-38967262 TGCAATAAACACAAGGGTGCAGG + Intronic
1039759260 8:40557177-40557199 TGCAATAAACATGAGAGTGCAGG - Intronic
1039806351 8:41003147-41003169 TGCAATAAACATATGGGTGCAGG + Intergenic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1041740387 8:61151254-61151276 TGCAATAAACAAAATGGAAAAGG + Intronic
1042089792 8:65146118-65146140 GGCAAGAGACATAATGGGGAGGG + Intergenic
1042930795 8:74012229-74012251 TGCAATAAACATATGAGTGCAGG - Intronic
1043283447 8:78499346-78499368 TGCAATAAACATGAGTGTGCAGG - Intergenic
1043331310 8:79121469-79121491 CTCAAAAACCATAAGGGGGATGG - Intergenic
1043348523 8:79329837-79329859 TGCAATAAACATGATGGTGCAGG - Intergenic
1043416599 8:80057376-80057398 TGCAATAAACATATGAGTGCAGG - Intronic
1043481859 8:80661484-80661506 TGCAATAAACATGAGAGTGCAGG - Intronic
1043936863 8:86152372-86152394 TGCAATAAACATATGTGTGCAGG + Intronic
1044390674 8:91647057-91647079 TGCAATGAACATAAGAGTGCAGG + Intergenic
1045072921 8:98529272-98529294 TTCAAAAAACAAAAGGGGGGGGG + Intronic
1045283367 8:100769090-100769112 TGCAGTAAACATGGGGGAGAAGG - Intergenic
1046002143 8:108434004-108434026 TGCAATGAACATAGGGGTGCAGG - Intronic
1046147674 8:110182491-110182513 TGCAGTAAACATAGGAGGGGAGG + Intergenic
1046250266 8:111622341-111622363 TGCAATAAACATGAGAGTGCAGG + Intergenic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1046810675 8:118529827-118529849 TGCAATAAACATACGAGTGCAGG + Intronic
1047146687 8:122208470-122208492 TGCAATAAACATATGAGTGCAGG + Intergenic
1048144823 8:131831138-131831160 TGCAATAAACATACGTGTGCAGG - Intergenic
1048905982 8:139089511-139089533 TGCCATAAACATGAGGGTGCAGG + Intergenic
1050389456 9:5123600-5123622 TGCAATAAACATACAGGTGGAGG + Intronic
1051282427 9:15455636-15455658 TGTAATAAACATAAGATGGAAGG + Intronic
1051354443 9:16229005-16229027 TGCAATAAACATATGTGTGCAGG - Intronic
1051972299 9:22904323-22904345 TGCAATAAATATATGGGTGCAGG + Intergenic
1052438808 9:28466155-28466177 TGCAATAAACATAGGAGTGCAGG - Intronic
1053094743 9:35315221-35315243 TGCAATAAACATATGGGTGCAGG + Intronic
1053670596 9:40358080-40358102 TGCTATAAACATGAGGGTGCAGG - Intergenic
1053920384 9:42984424-42984446 TGCTATAAACATGAGGGTGCAGG - Intergenic
1054381718 9:64498143-64498165 TGCTATAAACATGAGGGTGCAGG - Intergenic
1054475987 9:65573458-65573480 TGCAATAGTGAGAAGGGGGAAGG - Intergenic
1054514017 9:66018220-66018242 TGCTATAAACATGAGGGTGCAGG + Intergenic
1054802638 9:69365978-69366000 TGCAATAAACATAACGGTGCAGG + Intronic
1056059712 9:82871413-82871435 TGCAAGAAACATTAGGAGTAAGG - Intergenic
1056153092 9:83807115-83807137 TGAACTAAACATAATGTGGAAGG - Intronic
1057155451 9:92834264-92834286 TGCAATAAACATGAGGATGCAGG - Intergenic
1057492601 9:95533257-95533279 TGCAATAAACATGGGGGTGCAGG - Intergenic
1057502186 9:95604591-95604613 TGCAATAAACATATGCGTGCAGG + Intergenic
1058188245 9:101881433-101881455 TGAAACAAACAAAAGGGGAAGGG - Intergenic
1058352865 9:104047137-104047159 TGCAATAAACATGAGGATGTAGG - Intergenic
1059706730 9:116830831-116830853 TGCAGTAAACATATGAGGGCTGG - Intronic
1060097999 9:120810855-120810877 TGCAATATACATGAGGGTGCAGG + Intergenic
1203441566 Un_GL000219v1:14273-14295 TGCAATAAACATATGAGTGTGGG - Intergenic
1203512375 Un_KI270741v1:133181-133203 TGCAATAAACATATGAGTGTGGG - Intergenic
1185819505 X:3188365-3188387 TGTGATAAACATAAGAGTGAAGG + Intergenic
1186122570 X:6379873-6379895 TGCAATAAACATATGCGTGCAGG + Intergenic
1186239282 X:7548909-7548931 TGCAAGAAAAAAAAGGGGGGAGG - Intergenic
1186609250 X:11123176-11123198 TGCAATAAACATATGTGTGCTGG - Intergenic
1188077170 X:25792267-25792289 TGCAATAAACATAGGAGTGCAGG - Intergenic
1188172766 X:26948485-26948507 TGCAAAAAAACTGAGGGGGATGG - Intergenic
1188192908 X:27194400-27194422 TGAAATAAGCATAAGGGTGAAGG + Intergenic
1188361178 X:29255907-29255929 TGCAATAAACATATGAGTGCAGG + Intronic
1188603157 X:31994461-31994483 TGAAATAAACATAAGTTGGTAGG + Intronic
1188717995 X:33484810-33484832 TGCAATAAACATGAGAGTGCAGG - Intergenic
1188724587 X:33566704-33566726 TGCAATAAACATGAGAGTGTAGG + Intergenic
1189108306 X:38259600-38259622 TGCAATAAACATGGGGGTGCAGG + Intronic
1189628665 X:42927568-42927590 TGCAATAAACATGAGAGTGCAGG - Intergenic
1189716705 X:43874486-43874508 TACTATAAAGATAAGGTGGATGG - Intronic
1189879451 X:45474070-45474092 TGCAATAAACATACGGTTGCAGG + Intergenic
1190503787 X:51105124-51105146 TCCAATAATCATAAGCTGGAAGG - Intergenic
1190680452 X:52822646-52822668 TAGAATAAACCTAAGGGGAAAGG - Intergenic
1190837446 X:54113941-54113963 TGCAATAAACATACAGGTGCAGG - Intronic
1190896739 X:54626477-54626499 TGCAATAAACATAGGGGTGCAGG + Intergenic
1191219240 X:57969158-57969180 TGCAATAAACATGAGGATGCAGG + Intergenic
1192065224 X:67877988-67878010 TGCAATGAACATAAGAGTGAAGG - Intergenic
1192377923 X:70583561-70583583 TGCAATAAATATATGGGTGCTGG + Intronic
1192507125 X:71694422-71694444 TGCAATAAACATGGGGGTGTAGG - Intergenic
1192519572 X:71787124-71787146 TGCAATAAACATGGGGGTGTAGG + Intergenic
1192526671 X:71851898-71851920 TGCAATAAACATGGGGGTGTAGG - Intergenic
1193059619 X:77191177-77191199 TGTAATAAACATAAGAGTGCAGG + Intergenic
1193159776 X:78215341-78215363 TGCAATAAATAAACGGGGTAAGG + Intergenic
1193211762 X:78814929-78814951 TGCAATAAACATGAGGTTGCAGG - Intergenic
1193508959 X:82376411-82376433 TGCAATAAACATAGGGGTGCAGG + Intergenic
1193889355 X:87025232-87025254 TGCAATAAACATAAGAATGCAGG + Intergenic
1193970499 X:88045451-88045473 TGCAATAAACATGAGGGTGCAGG - Intergenic
1194011110 X:88562995-88563017 TGCAATAAACCTAAGAGTGTGGG - Intergenic
1194689024 X:96959043-96959065 TGCAATAAACATGAGGGTGCAGG + Intronic
1195153208 X:102095676-102095698 TGCAATAAACATAGAGGTGCAGG - Intergenic
1195178666 X:102335177-102335199 TGCAATAAACATAGGGGTGCAGG - Intergenic
1195180198 X:102351906-102351928 TGCAATAAACATAGGGGTGCAGG + Intergenic
1195934572 X:110112628-110112650 TGCAATAAACTTATGAGGCAAGG + Intronic
1196577854 X:117341184-117341206 TGCAATAAACATAAAGGTGTAGG - Intergenic
1196793518 X:119484724-119484746 TGCAATAAACATGGGGAGGCAGG + Intergenic
1197110531 X:122768789-122768811 TGCAATAAACATATGAGTGCAGG - Intergenic
1197328014 X:125117911-125117933 TGCAATAAACATATGTGTGCAGG - Intergenic
1197424237 X:126275217-126275239 TGCAAGAAACATAAGGAGAGAGG + Intergenic
1197427279 X:126313127-126313149 TGCAATAAACATATGAGTGCAGG - Intergenic
1197458995 X:126715565-126715587 TGCAATAAACATATGAGTGCAGG - Intergenic
1197518583 X:127469272-127469294 TTTAATAAACATAATGGAGATGG + Intergenic
1197617145 X:128705821-128705843 TGCAATAAACATAGGGGTGCAGG + Intergenic
1198424611 X:136504171-136504193 TGAAATAAAAATAATGGGCAGGG - Intronic
1198658843 X:138944325-138944347 TTCAATAAGCCTAAGGGAGATGG + Intronic
1200050883 X:153431017-153431039 TGCATTAGACAGAAGGAGGAAGG + Intergenic
1201402084 Y:13614203-13614225 TACAATAAGTATAAAGGGGAGGG - Intergenic