ID: 1099365067

View in Genome Browser
Species Human (GRCh38)
Location 12:81758578-81758600
Sequence CCGGTGGCGTGGCAGGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 13, 3: 19, 4: 241}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099365054_1099365067 -1 Left 1099365054 12:81758556-81758578 CCCTCCCGGAACGTGCCCCGGCC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG 0: 1
1: 0
2: 13
3: 19
4: 241
1099365050_1099365067 7 Left 1099365050 12:81758548-81758570 CCCCGGCGCCCTCCCGGAACGTG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG 0: 1
1: 0
2: 13
3: 19
4: 241
1099365052_1099365067 5 Left 1099365052 12:81758550-81758572 CCGGCGCCCTCCCGGAACGTGCC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG 0: 1
1: 0
2: 13
3: 19
4: 241
1099365051_1099365067 6 Left 1099365051 12:81758549-81758571 CCCGGCGCCCTCCCGGAACGTGC 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG 0: 1
1: 0
2: 13
3: 19
4: 241
1099365057_1099365067 -5 Left 1099365057 12:81758560-81758582 CCCGGAACGTGCCCCGGCCCGGT 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG 0: 1
1: 0
2: 13
3: 19
4: 241
1099365058_1099365067 -6 Left 1099365058 12:81758561-81758583 CCGGAACGTGCCCCGGCCCGGTG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG 0: 1
1: 0
2: 13
3: 19
4: 241
1099365055_1099365067 -2 Left 1099365055 12:81758557-81758579 CCTCCCGGAACGTGCCCCGGCCC 0: 1
1: 0
2: 7
3: 48
4: 418
Right 1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG 0: 1
1: 0
2: 13
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099365067 Original CRISPR CCGGTGGCGTGGCAGGAGCT CGG Intronic
900598432 1:3493029-3493051 CCTGGGGCGGGGCAGGAACTCGG - Intronic
901817022 1:11800171-11800193 CTGGTGGCGGGGATGGAGCTAGG - Intronic
902652548 1:17846009-17846031 CAGCTGGCCTGGCTGGAGCTCGG - Intergenic
904006689 1:27366636-27366658 CCGGGGGCGGGGCAGGAGCCTGG + Exonic
904703425 1:32372883-32372905 CCTGTGGCCTGGAAGGAGCCTGG - Intronic
905461590 1:38126101-38126123 CCGGTGCGGAGGCAGGAGATGGG + Intergenic
905990503 1:42334328-42334350 CGGGTGGCGTGGAAGGTGTTAGG - Intronic
907065868 1:51482515-51482537 ACAGTGGCGTGGCACGATCTAGG + Intronic
912505928 1:110156101-110156123 CCAGTGGTGTGGCAGGACCATGG - Intronic
913450111 1:118987507-118987529 CCGGTCGCGGGTGAGGAGCTAGG - Intronic
915246307 1:154558498-154558520 CCGGGGCCGGGGCAGCAGCTGGG - Exonic
915586907 1:156848891-156848913 CCGGGGGCGGGGCCGGAGCGGGG - Intronic
915714250 1:157929650-157929672 GCCGTGGTGTGCCAGGAGCTGGG + Intergenic
917850595 1:179060399-179060421 TCTGTGGCGTGGTAGGAACTGGG + Intronic
918008153 1:180561406-180561428 CAGGTGGTGTTGCAGGAGATGGG + Intergenic
918309022 1:183272333-183272355 GCAGTGGGGTGGCAGGAGCTGGG + Intronic
920260514 1:204685172-204685194 GCGGTGCCGGGGCAGGAGCCAGG + Intronic
920380573 1:205532435-205532457 CCTCTGGGGTGGCAGGGGCTGGG - Intronic
921039467 1:211416435-211416457 CCGCGGGCGAGGCAGGAGCGCGG + Intergenic
1062838401 10:651047-651069 CAGGAGGGGTGGCAGGGGCTAGG - Exonic
1069432993 10:68354056-68354078 CCCTTTGGGTGGCAGGAGCTAGG + Intronic
1069914905 10:71781468-71781490 CTGGTGGAGAGGCAGGTGCTGGG + Intronic
1070097794 10:73355156-73355178 CCCGTGGCCTGTCAGGAACTGGG + Intronic
1072981398 10:100100860-100100882 CCGAGGCCGTGGCAGGAGATGGG - Intergenic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1075802355 10:125160995-125161017 CCGCTGGCTGCGCAGGAGCTAGG + Intronic
1076707144 10:132308117-132308139 CCGGGGGCGGGGCAGGGGCGGGG + Intronic
1076830754 10:132993010-132993032 CCGGGGGCGGGGCTGGTGCTGGG - Intergenic
1076871817 10:133198272-133198294 CCGGTGGTGCGGCACGTGCTGGG + Intronic
1077048392 11:555959-555981 CCGGTGGGGCGGCCGGGGCTGGG - Intronic
1081773603 11:45664171-45664193 CTGGAGGGGTGGGAGGAGCTGGG - Intronic
1082261263 11:50077625-50077647 GCTGTGGGGGGGCAGGAGCTAGG + Intergenic
1082785623 11:57314715-57314737 CAGGTGGAGTGCCAGGTGCTTGG - Intronic
1083628013 11:64081875-64081897 TCGGTGGTGGGGCTGGAGCTTGG + Intronic
1083858144 11:65404090-65404112 CCTGTGGAGAGGCAGGAGCCAGG + Intronic
1083897445 11:65627170-65627192 GGGATGGCGTGTCAGGAGCTGGG - Intronic
1084174337 11:67415768-67415790 CCCGGGGCGGGGCCGGAGCTGGG - Intronic
1084890487 11:72234396-72234418 TCAGAGGCGTGGCAGGGGCTGGG + Intronic
1085832571 11:79917134-79917156 GCGGTGGCGTGGCATGATCTTGG + Intergenic
1090196881 11:124824174-124824196 GCGGTGGCCTGCCAGCAGCTGGG - Intergenic
1094496391 12:30992034-30992056 TCGGTGGATTCGCAGGAGCTAGG - Exonic
1096157315 12:49347794-49347816 GCGGTGGTGTGGGAGGAGCTGGG + Exonic
1096217308 12:49805022-49805044 CCACTGCCCTGGCAGGAGCTAGG + Intronic
1096526739 12:52214555-52214577 CAGGTGAGGTGGCAGGAGCAAGG - Intergenic
1096656463 12:53095663-53095685 CCTGTGGCGGGGTAGGGGCTAGG + Intergenic
1097188985 12:57210562-57210584 CTGGAGGCGAGGCAGGGGCTGGG - Intronic
1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG + Intronic
1102937579 12:116910887-116910909 CCGGGGGCGTGGCGGGGGCGTGG + Intergenic
1103702748 12:122856203-122856225 CGTGTGGGGTGGCAGGGGCTGGG - Intronic
1104948595 12:132428572-132428594 CCGGGTGGGTGGCTGGAGCTGGG - Intergenic
1104951367 12:132442076-132442098 CCGGACGCATGGCAGGAGCAGGG - Intergenic
1107048988 13:36027400-36027422 CTGGTGGCATGTTAGGAGCTGGG - Intronic
1108023551 13:46154604-46154626 CTGGTGGAGTGGTAGCAGCTGGG - Intronic
1109024461 13:57141149-57141171 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109025448 13:57147719-57147741 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109026438 13:57154292-57154314 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109027430 13:57160863-57160885 CCGGAGGCGTGGACGGATCTCGG + Intronic
1109028416 13:57167428-57167450 CCGGAGGCGTGGACGGATCTCGG + Intronic
1111676778 13:91398539-91398561 CCGGGGGCGTGGCAGGGGCGTGG + Intergenic
1113661369 13:112108284-112108306 CAGGTGGGGTGGCAGGAGCTGGG - Intergenic
1114417121 14:22552385-22552407 CCCGTGGCGTGGCATGAGAGTGG - Intergenic
1117784682 14:59270376-59270398 GTGGTGGGGTGGCAGGTGCTAGG + Intronic
1118373563 14:65157851-65157873 CCAGTGGCGAGGGATGAGCTGGG + Intergenic
1119195454 14:72714154-72714176 CAGGAGGCATGGCAGGAGGTGGG + Intronic
1121813406 14:96911212-96911234 CCAGTCACGTGGCAGGAGCAGGG + Intronic
1122887471 14:104716626-104716648 CCACGTGCGTGGCAGGAGCTGGG - Intronic
1125729928 15:41887352-41887374 CTGGTGGCTGAGCAGGAGCTGGG - Exonic
1128251446 15:66166806-66166828 CAGGTGGCGTGCCAGGGCCTGGG - Intronic
1128706813 15:69842678-69842700 CAGGTGGCCTGGCATGAGGTAGG + Intergenic
1129868690 15:78927538-78927560 ATGGTGGCGAGGCAGGAGATGGG - Intronic
1131694108 15:94856554-94856576 CCGGTGCCGGGGCCGGAGCCTGG - Intergenic
1132480810 16:165317-165339 CCGGGGGCTTCGCAGGAACTCGG + Intronic
1132496157 16:264442-264464 CAGGTGGGGTGGGAGGACCTGGG + Intronic
1132572689 16:650907-650929 CTGGTGGCGTGGCAGTGCCTTGG + Intronic
1132588103 16:715004-715026 GCGGGGGCGGGGCCGGAGCTCGG - Intronic
1132809309 16:1789968-1789990 GCGGTGGCGGGGCAGGATCCAGG + Intronic
1132855028 16:2040917-2040939 CCGCTGCAGTGGCAGGTGCTAGG - Intronic
1133746644 16:8692049-8692071 CCAGTAGAGTGGCAGGACCTGGG + Intronic
1133828852 16:9303138-9303160 CGGGTGGCGGGGGAGGAGGTGGG + Intergenic
1137712273 16:50574634-50574656 CCTGGGGCGTGCCAGGAGCCAGG + Intronic
1138059798 16:53878245-53878267 ACAGTGGCGTGGCATGATCTTGG - Intronic
1139394285 16:66627862-66627884 CCGGTGCCGGGGCAGGTCCTTGG - Intronic
1139678236 16:68539753-68539775 CCGGCTCCGGGGCAGGAGCTGGG - Exonic
1139702324 16:68715683-68715705 CCTGTGGGGTGGCAGGAAGTGGG - Intronic
1142023947 16:87802255-87802277 GAAGTGCCGTGGCAGGAGCTTGG - Intergenic
1142293206 16:89201935-89201957 CCGGGGGCGTGGCAGGGGCGTGG + Intergenic
1142807730 17:2380227-2380249 AGGGTGGGGTGGCAGGAGCGAGG - Exonic
1143492767 17:7293967-7293989 CCGGGGGCGTGGCCGGACCCTGG + Intronic
1143881763 17:10035362-10035384 CCGGTGCTGGGGCAGGACCTGGG - Intronic
1146673192 17:34756142-34756164 CTGGAGGCGTGGCTGGTGCTTGG - Intergenic
1147176116 17:38657308-38657330 GGGGTGGGGTGGCAGGAGGTGGG - Intergenic
1147418485 17:40310179-40310201 CCTGTAGCGGGGCAGAAGCTTGG - Intronic
1147516651 17:41124034-41124056 CAGGTGGTCTGGCAGCAGCTGGG + Exonic
1147518942 17:41149679-41149701 CAGGTGGTCTGGCAGCAGCTGGG + Exonic
1147519890 17:41160603-41160625 CAGGTGGTCTGGCAGTAGCTGGG + Exonic
1147520496 17:41167787-41167809 CAGGTGGTCTGGCAGCAGCTGGG + Exonic
1147520539 17:41168072-41168094 CAGGTGGTCTGGCAGCAGCTGGG + Exonic
1147521552 17:41178076-41178098 CAGGTGGTCTGGCAGCAGCTGGG + Exonic
1147522239 17:41184754-41184776 CAGGTGGTCTGGCAGCAGCTGGG + Exonic
1147522399 17:41187036-41187058 CAGGTGGTCTGGCAGCAGCTGGG + Intergenic
1147722599 17:42548118-42548140 CCGGTGCTGGGGCAGGAGATGGG + Intergenic
1149434977 17:56625997-56626019 CCCGTGAAGTGGCAGGAGCCGGG + Intergenic
1150132832 17:62678552-62678574 CAGGGGGCCTGCCAGGAGCTGGG + Exonic
1151685241 17:75642394-75642416 GCGGGGGTGTGGCAGGGGCTGGG - Intronic
1151919110 17:77140757-77140779 CCGCGAGCGTGGGAGGAGCTCGG - Intronic
1152310724 17:79548199-79548221 CCGGGAGCGGAGCAGGAGCTGGG - Intergenic
1152900175 17:82936673-82936695 CCTGTTGGGTGGCTGGAGCTTGG + Intronic
1153524565 18:5982258-5982280 AGGGTGGGGTGGCAGGAGCTGGG - Intronic
1154049029 18:10935795-10935817 CTGCTGGCGAGGCAGGAGCAGGG - Intronic
1154530857 18:15343881-15343903 CCGGTGCCGGTGCAGGTGCTTGG - Intergenic
1159135480 18:64332248-64332270 CCAGTGACTTGACAGGAGCTGGG + Intergenic
1160517419 18:79486373-79486395 CCGGCCACGAGGCAGGAGCTGGG - Exonic
1160975205 19:1789645-1789667 GACGAGGCGTGGCAGGAGCTCGG - Exonic
1161563753 19:4988091-4988113 GCGGTGCAGGGGCAGGAGCTGGG + Intronic
1161566208 19:5004305-5004327 CCTGTGGCAGGGCAAGAGCTGGG - Intronic
1162249944 19:9433925-9433947 CCAGTGCAGTGGCAGGATCTCGG - Intronic
1162257041 19:9498831-9498853 CCGGGGGCGGGGCTGGAGGTGGG + Intergenic
1162672288 19:12267093-12267115 GCAGTGGCGTGGCATGATCTCGG + Intronic
1162805468 19:13135935-13135957 CCGGTGGGGTGGCAGCAGCAGGG + Exonic
1163183238 19:15618546-15618568 GAGGAGGCGTAGCAGGAGCTGGG + Intronic
1164562012 19:29299138-29299160 CAGGTGGGCTGGCAGGAGGTGGG - Intergenic
1165662581 19:37594634-37594656 CCGGTGTCCTGGCTGGGGCTCGG - Intronic
1167103253 19:47416879-47416901 CCCGTGACGGGGCCGGAGCTGGG - Exonic
1167254883 19:48421479-48421501 AGGCTGGCATGGCAGGAGCTGGG - Intronic
1167704008 19:51067706-51067728 CAGGTGGTGTGGCTGGAGGTAGG + Intergenic
1168110080 19:54187270-54187292 GCCAGGGCGTGGCAGGAGCTGGG + Exonic
1168301449 19:55407418-55407440 CCGCAGGCGGAGCAGGAGCTCGG - Intronic
925216076 2:2096957-2096979 CCGCTGGCGTGAGAGGAGCTGGG - Intronic
926733829 2:16057766-16057788 ACGGTGGCGTTGCTGGAGCCTGG + Intergenic
927188760 2:20501303-20501325 CCGGTGCCGGTGCAGGACCTTGG - Intergenic
932236567 2:70125273-70125295 GCGGCAGCGTGGCAGGAGCGAGG - Intergenic
932817445 2:74873373-74873395 TGAGTGGGGTGGCAGGAGCTTGG + Intronic
933774057 2:85761170-85761192 CCGGTGTGGTGGTGGGAGCTGGG + Intronic
935177588 2:100663398-100663420 CCCGCAGCCTGGCAGGAGCTGGG - Intergenic
936389114 2:112055617-112055639 GCGGCGGCGTGGCAGGAGCCCGG - Exonic
938287300 2:130128817-130128839 CCGGTGGCGGGGGAGGGGTTAGG - Intronic
938428293 2:131210052-131210074 CCGGTGGCGGGGGAGGGGTTAGG + Intronic
939024444 2:136995274-136995296 GGGATGGTGTGGCAGGAGCTGGG + Intronic
939466297 2:142561699-142561721 AAGTTGGCGGGGCAGGAGCTCGG + Intergenic
941476089 2:165953596-165953618 CCGGGGGCGCGGAGGGAGCTCGG - Intronic
942929557 2:181473173-181473195 CCCGTGGCCTGGTAGGAACTGGG + Intronic
946031518 2:216708714-216708736 CCGGGGTGGTGGCAGGAGGTAGG - Intergenic
946053666 2:216883591-216883613 CTGGTGGTGTGGCAGGAACCAGG + Intergenic
946295127 2:218777925-218777947 GAGGTGGAGTGGCAGGAGATGGG + Intergenic
946342666 2:219081237-219081259 GAGGTGGAGAGGCAGGAGCTTGG + Intronic
947623325 2:231604585-231604607 CCCGTGTCGGGGCCGGAGCTGGG + Intergenic
948479244 2:238239916-238239938 CCGGGGACGCGGCAGGGGCTAGG + Exonic
948768489 2:240235439-240235461 CCGGTGGGGTGACAGCAGCAGGG - Intergenic
1168808617 20:688398-688420 CTGGTGACGTGCCAGGACCTGGG + Intergenic
1171340198 20:24421336-24421358 CAGTGGGCGGGGCAGGAGCTGGG + Intergenic
1172070457 20:32252846-32252868 GCAGTGGCGTGGCATGATCTTGG + Intergenic
1174330807 20:49815834-49815856 GGGGTGGGGTGGCAGGAGGTGGG + Intronic
1176123295 20:63463900-63463922 CTGGGGGTGTGGCAGGGGCTGGG - Intronic
1178103114 21:29291458-29291480 AAGGTGGCCTGGCAGGAGCTGGG + Intronic
1178395507 21:32239297-32239319 CTGGTGGGGAGGCAGGAGCTAGG + Intergenic
1178513799 21:33229832-33229854 CCGCTGGCGGGGCTGGAGCAGGG - Intergenic
1179553899 21:42160406-42160428 CAGGCGCCGTGGCAGGGGCTGGG + Intergenic
1179944935 21:44666786-44666808 CAGGATGCCTGGCAGGAGCTGGG + Exonic
1180137398 21:45870700-45870722 ACGGTCGCGTGGCAGGCGGTGGG - Intronic
1181064148 22:20297798-20297820 CCGATGGCATGACAGGTGCTGGG + Intergenic
1183120875 22:35729036-35729058 CAGGTGGCGTGGCAGGTGGCCGG - Intronic
1183247601 22:36705847-36705869 TAGGTGGCTTGGCAGTAGCTGGG - Intergenic
1183281231 22:36933719-36933741 CCTGGGGTATGGCAGGAGCTAGG + Intronic
1183368026 22:37417474-37417496 CGGGTGATGGGGCAGGAGCTGGG + Intronic
1183490858 22:38114947-38114969 CCTGTGGCGTGGCGGGCGGTGGG - Intronic
1183744676 22:39685746-39685768 CCGGTGGCCTGGGGGGAGGTGGG - Exonic
1184060201 22:42076997-42077019 CAGGAGGCATGGCAGGACCTGGG - Intronic
1184994184 22:48192808-48192830 CTTGTGGAGAGGCAGGAGCTTGG - Intergenic
1185306109 22:50117661-50117683 CGGGAGAGGTGGCAGGAGCTGGG - Intronic
1185342221 22:50296799-50296821 CCGGTGGGGTGGGAGGAGAGTGG - Intronic
1185371368 22:50462466-50462488 GTGGTGCCGTGGCAGGAGGTTGG - Exonic
953389817 3:42527621-42527643 AAGCTGGCCTGGCAGGAGCTGGG - Intronic
954710093 3:52501342-52501364 CCTGTGGGGTGGCAGGGACTCGG + Intronic
960320317 3:116226858-116226880 GTGGTGGCGTGTGAGGAGCTTGG - Intronic
961431895 3:126889519-126889541 CCAGTGGCTCAGCAGGAGCTGGG - Intronic
962530777 3:136277872-136277894 CAGGTGGCCTGGGAGGAGCATGG - Intronic
963235015 3:142947611-142947633 CGGGAGGCGTGGCAGGGGCCGGG - Intergenic
965984746 3:174737091-174737113 CCCATGGCCTGGCAGGAGCCAGG - Intronic
977445169 4:97122309-97122331 CCTGGAGAGTGGCAGGAGCTTGG - Intergenic
981905152 4:149914321-149914343 CTGGTGGTGTGGAAGGATCTGGG - Intergenic
985544935 5:504760-504782 TCGGTGGCCGGCCAGGAGCTGGG - Intronic
986276663 5:6281250-6281272 CCTGTGGGGTGGGAGGAGGTTGG - Intergenic
991059379 5:62356834-62356856 GAGGTGGAGTGGCAGGATCTCGG + Intronic
991451442 5:66754993-66755015 CGAGTGGAGTGGCAGGAGCTGGG + Intronic
991592148 5:68264657-68264679 CCTGTGGGGTGGGAGGAGTTAGG - Intronic
992476033 5:77102521-77102543 CCTGAGGCAGGGCAGGAGCTAGG + Intergenic
994219834 5:97183003-97183025 CCCGGGACGTGGCAGAAGCTGGG - Exonic
995872725 5:116759674-116759696 CAGGTGGGGTGGCAGGCGCCTGG + Intergenic
997362863 5:133306180-133306202 CAGGTGAGGTGGCAGGAGTTGGG + Intronic
998387445 5:141765893-141765915 CGGGTGGAGTGGAAGGGGCTTGG + Intergenic
1000295170 5:159907125-159907147 CAGGTGGAGTGGCAGGTCCTTGG - Intergenic
1001777180 5:174337599-174337621 TCGGTGGGGTGGCAGGGGGTTGG + Intergenic
1002134832 5:177101039-177101061 CCGGCAGCATGGCAGCAGCTGGG + Intergenic
1002316740 5:178348761-178348783 CAGGTGGAGTGGCAGGACCCAGG - Intronic
1004171608 6:13299692-13299714 CAGGTGGAGGGGAAGGAGCTGGG + Intronic
1004474261 6:15956572-15956594 CCGGTGGCCTGCCAGCACCTGGG + Intergenic
1006037231 6:31223183-31223205 CCAGTGGCCTGGGAGCAGCTGGG - Intergenic
1006277103 6:33013818-33013840 CTGCTGGAGTGGGAGGAGCTGGG - Intergenic
1006453779 6:34120643-34120665 GGGGTGATGTGGCAGGAGCTGGG - Intronic
1007032296 6:38639665-38639687 CCGGGGGCGGGGGAGGAGCTGGG - Intronic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1007629153 6:43263202-43263224 CAGCTGGGGTGGCAGGGGCTGGG - Exonic
1009358038 6:62776503-62776525 CAGGTGTAGTGGCAGGAGCCTGG + Intergenic
1009876437 6:69511517-69511539 CCAGTGGTCTGGCAGGACCTTGG + Intergenic
1013175756 6:107675269-107675291 ACCGTGGCTTGGCAGGGGCTGGG + Intergenic
1015686737 6:135871512-135871534 TGGGTGGGGTGGGAGGAGCTAGG + Intronic
1017261362 6:152391463-152391485 CTGGTGGCTTGTGAGGAGCTGGG + Exonic
1017929537 6:158939734-158939756 CCGGTGGCGCTGCAGCAGCCCGG - Intergenic
1018591696 6:165432437-165432459 CAGGTGGGGTCGCAGGAGATGGG + Intronic
1018631508 6:165826560-165826582 CTGGGGGCGTGGCGGGAGCGTGG - Intronic
1019715812 7:2538793-2538815 TTGGTGGGGTGGCAGGAGCGAGG + Intronic
1023662594 7:42485903-42485925 CCAGTTGTGTGGCAGGAGATGGG + Intergenic
1024556041 7:50604443-50604465 CCAGTGGCCTGCCATGAGCTTGG - Intronic
1025182782 7:56832076-56832098 CCTGTCGGGGGGCAGGAGCTGGG + Intergenic
1025689144 7:63744898-63744920 CCTGTCGGGGGGCAGGAGCTGGG - Intergenic
1026045267 7:66902455-66902477 CCTGTTGCGAGGCAGGAGCTGGG - Intergenic
1026935823 7:74254681-74254703 GCGGCGGCGTGGGAGGAGCAGGG + Intergenic
1027202236 7:76071602-76071624 GCTGTTGCGAGGCAGGAGCTGGG + Intergenic
1027202532 7:76072750-76072772 GCTGTTGCGAGGCAGGAGCTGGG + Intergenic
1028925256 7:96350558-96350580 CAGGTGTGGTGGCAGGTGCTTGG - Intergenic
1034223103 7:149460492-149460514 CCGGGGCCGGGGCCGGAGCTGGG - Intronic
1034439328 7:151078634-151078656 CCGGTGCCGGGCCAGGTGCTGGG + Exonic
1035624021 8:1058334-1058356 TCGGAGCCGTGGCAGGTGCTGGG - Intergenic
1036619659 8:10416095-10416117 CAGGTGCCGTGCCAGGTGCTGGG - Intronic
1037446522 8:18971300-18971322 CCTGTGGTGTGGCAGGACCTTGG - Intronic
1037764589 8:21764601-21764623 CCTTTGGCGAGGCTGGAGCTGGG - Intronic
1039458341 8:37723185-37723207 ACGGTGGGGTGGGAGGAGATTGG - Intergenic
1040914898 8:52558983-52559005 CCCGTGGCCTGACAGGAGCAAGG + Intronic
1042150782 8:65781300-65781322 AGGCTGGCGTGGCAGGAGCAAGG + Intronic
1043889745 8:85642758-85642780 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043891281 8:85654666-85654688 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043892355 8:85661503-85661525 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043893202 8:85715832-85715854 CCGGTGGCGTGGCTGGATCTGGG - Intergenic
1043895889 8:85737286-85737308 CCGGTGGCGTGGCTGGATCTGGG - Intergenic
1043896790 8:85744522-85744544 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043899113 8:85762888-85762910 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043900724 8:85775083-85775105 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043902688 8:85790358-85790380 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043904298 8:85802551-85802573 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043905910 8:85814745-85814767 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1043907518 8:85826932-85826954 CCGGTGGCGTGGCTGGATCTGGG + Intergenic
1045304861 8:100950773-100950795 TCGGTGGCGGGGAAGGCGCTGGG - Intronic
1047252749 8:123193007-123193029 CTGGTGGCTTGGCAGGTCCTGGG - Intronic
1047254432 8:123205392-123205414 CCCGTGGCGGGGCTGGCGCTTGG + Intronic
1048221539 8:132546747-132546769 CCGGTGGTGTGGCAGGAGAAAGG - Intergenic
1048992552 8:139769945-139769967 CCTGGGGAGTTGCAGGAGCTAGG - Intronic
1049275431 8:141717895-141717917 GAGGGGGCGTGCCAGGAGCTGGG - Intergenic
1052273624 9:26653703-26653725 CCAGAGGCATGGCAGCAGCTTGG - Intergenic
1053418350 9:37960972-37960994 CTGCTGGTCTGGCAGGAGCTGGG + Intronic
1053708560 9:40781625-40781647 CCGGTGCCGGTGCAGGTGCTTGG - Intergenic
1054418471 9:64902420-64902442 CCGGTGCCGGTGCAGGTGCTTGG - Intergenic
1054787192 9:69221126-69221148 CCGGAGCCGTGGCCGGAGCCTGG + Exonic
1057132244 9:92662101-92662123 CTGGTGAGCTGGCAGGAGCTCGG - Intronic
1057221498 9:93260051-93260073 CCGATAGCGGGGCAGGGGCTGGG + Intronic
1057269669 9:93643799-93643821 ACGGTGGAGGGGCAGGAGCTGGG - Intronic
1057478703 9:95426980-95427002 CCGGAGCCGGGGCAGGAGCCGGG - Intergenic
1058687415 9:107490333-107490355 CCGGTGGCGGTGCCGGCGCTCGG + Intronic
1058947420 9:109870677-109870699 ACGGTGGCCTGGAAAGAGCTCGG - Intronic
1059458265 9:114413325-114413347 CCGGTGGCACGGCCAGAGCTGGG + Intronic
1060533513 9:124364115-124364137 CCGGGGGTGTGGCAGGTGCCTGG - Intronic
1062042525 9:134410687-134410709 CCCGAGGCGTGGCTGGAGCTGGG + Intronic
1062081567 9:134626761-134626783 CCGGTGATGTGGCAGGCCCTCGG - Intergenic
1062162419 9:135087686-135087708 CCGGTGGCGGCGGAGGAGCCCGG + Intronic
1062385699 9:136310695-136310717 CCGAGGGCGTTGCAGGGGCTGGG - Intergenic
1062450886 9:136615244-136615266 CAGGTGCTGTGGCAGGGGCTGGG - Intergenic
1062482515 9:136759182-136759204 CCGGTGCCGGGGGGGGAGCTGGG - Intergenic
1062655917 9:137604760-137604782 CGGGGGGCGGGGCAGGTGCTGGG + Intergenic
1185932558 X:4219244-4219266 CTGATGGAGTGCCAGGAGCTGGG - Intergenic
1186496499 X:10015709-10015731 GCGGCGGCGCGGAAGGAGCTGGG - Exonic
1197821027 X:130540990-130541012 CGGGGGGAGTGTCAGGAGCTGGG + Intergenic
1198329240 X:135606235-135606257 CAGGCAGCGTGCCAGGAGCTGGG - Intergenic
1199677440 X:150200008-150200030 CCGGGGGCATGGTTGGAGCTTGG + Intergenic
1200130619 X:153842423-153842445 GCAGTGGCGTGGCATGATCTCGG + Intergenic
1200142409 X:153908664-153908686 GCGGTGCCATGGCAGGCGCTTGG - Intronic