ID: 1099365144

View in Genome Browser
Species Human (GRCh38)
Location 12:81758953-81758975
Sequence CTCCAGGAGGGGAGACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 426}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099365144_1099365160 23 Left 1099365144 12:81758953-81758975 CCACCCAGTCTCCCCTCCTGGAG 0: 1
1: 0
2: 4
3: 46
4: 426
Right 1099365160 12:81758999-81759021 CCTGGGAGTTAGAAACCTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1099365144_1099365157 6 Left 1099365144 12:81758953-81758975 CCACCCAGTCTCCCCTCCTGGAG 0: 1
1: 0
2: 4
3: 46
4: 426
Right 1099365157 12:81758982-81759004 TGGAGTTTAAGGCTAACCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1099365144_1099365156 5 Left 1099365144 12:81758953-81758975 CCACCCAGTCTCCCCTCCTGGAG 0: 1
1: 0
2: 4
3: 46
4: 426
Right 1099365156 12:81758981-81759003 CTGGAGTTTAAGGCTAACCCTGG 0: 1
1: 0
2: 5
3: 69
4: 1453
1099365144_1099365152 -5 Left 1099365144 12:81758953-81758975 CCACCCAGTCTCCCCTCCTGGAG 0: 1
1: 0
2: 4
3: 46
4: 426
Right 1099365152 12:81758971-81758993 TGGAGCCCCTCTGGAGTTTAAGG 0: 1
1: 0
2: 0
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099365144 Original CRISPR CTCCAGGAGGGGAGACTGGG TGG (reversed) Intronic
900245221 1:1633360-1633382 CTCCAGGAGGCCAGCCTGGACGG - Intronic
900256452 1:1700519-1700541 CTCCAGGAGGCCAGCCTGGACGG - Intronic
900325044 1:2104555-2104577 CCCTAAGAGGGGAGGCTGGGAGG + Intronic
900645922 1:3708744-3708766 GTGCAGGAGGGGAGACCCGGAGG - Intronic
901262677 1:7885532-7885554 CAGCAGGAGTGGAGGCTGGGTGG - Intergenic
901740995 1:11341802-11341824 GCCCAGGTGGGGAGAGTGGGCGG + Intergenic
902701642 1:18176243-18176265 CTGCAGGAGGGGACACAGAGAGG + Intronic
903576318 1:24341789-24341811 CCCAAGGGGTGGAGACTGGGGGG - Intronic
904257005 1:29260339-29260361 CTCCAGGAGGCGAGGATGTGGGG + Intronic
904876242 1:33656646-33656668 CTCCAGCAGGGGAGGCAGTGTGG + Intronic
904886734 1:33743756-33743778 CTCCAGGTGGGGAGACATGCTGG + Intronic
905313669 1:37067697-37067719 CTCCAGGAGAGGAGAAGAGGAGG - Intergenic
905690095 1:39936673-39936695 CTCCACGAGGGAAGGCAGGGTGG - Intergenic
905853021 1:41288158-41288180 CTCCAGGCAGGGAGGCTTGGAGG + Intergenic
905891541 1:41521449-41521471 GTCCAGGAGTGGACACTGGATGG + Intronic
906465898 1:46078962-46078984 CTGAGGGAGGGGAGAATGGGGGG + Intronic
907416448 1:54317717-54317739 CTCAAGGAGGGAAGACAGTGAGG + Intronic
907471750 1:54678872-54678894 ATCCAGGAGCGGAGGGTGGGGGG + Intronic
907976002 1:59432050-59432072 CACCAGGAGGGGAGAGAGGCTGG + Intronic
909445438 1:75743595-75743617 CCCCAGGATGGCAGACAGGGGGG + Intronic
910452770 1:87363961-87363983 CTCGAGGATGGGGGCCTGGGTGG - Intergenic
912272814 1:108228060-108228082 CTCCAGGAGGAGATATTGAGTGG + Intronic
912295406 1:108466262-108466284 CTCCAGGAGGAGATATTGAGTGG - Intronic
914250966 1:145920985-145921007 CTGAAGGAGGTGAGATTGGGAGG - Intergenic
914314829 1:146500207-146500229 CTCCAGGAGGAGATATTGAGTGG + Intergenic
914379377 1:147102754-147102776 CTCCAGGAGGAGATATTGAGTGG + Intergenic
914499522 1:148233181-148233203 CTCCAGGAGGAGATATTGAGTGG - Intergenic
914890066 1:151613601-151613623 CTGCAGCAGGGGAGAGAGGGTGG - Intronic
915720799 1:157984039-157984061 CTCCAGGAGTGGAGAGTCAGTGG + Intergenic
916695166 1:167228021-167228043 GGGCAGGAGGAGAGACTGGGAGG - Intronic
918558688 1:185838016-185838038 CTCCAGGCATGGAGACTGAGAGG + Intronic
919772365 1:201170860-201170882 CTCCCGGGGTGGAGACTGGACGG - Intronic
919856748 1:201711383-201711405 GTCAGGGAGGGGAGGCTGGGTGG - Intronic
921880273 1:220247590-220247612 CTCGATGAGGGGAGGTTGGGAGG + Intronic
922285553 1:224167770-224167792 CTCAAGGGGAGGAGACTAGGAGG + Intergenic
922578435 1:226679111-226679133 CTGCAGGAAGAGATACTGGGAGG - Intronic
922983931 1:229851420-229851442 GGCCAGGAGGGGATCCTGGGAGG - Intergenic
923050362 1:230387488-230387510 ATCCAGGAGGCCAGGCTGGGGGG + Intronic
923803046 1:237229135-237229157 CTCCAGGAAAGGAGAGAGGGTGG + Intronic
923829865 1:237542941-237542963 CTACAGGAGGGGAGAGTCAGAGG - Intronic
924103578 1:240628769-240628791 CTCCAGGATGGAAGAGTGGATGG - Intergenic
924623588 1:245683085-245683107 CTCAGGGAGGGAAGACTGTGGGG - Intronic
1062809996 10:455995-456017 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1062810003 10:456052-456074 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1062810019 10:456166-456188 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1062810061 10:456451-456473 CTGCCTGAGGGGAGACTGTGAGG + Intronic
1062970653 10:1645762-1645784 CTCCAGGAGGAGAGGCAGAGGGG - Intronic
1063420273 10:5906918-5906940 CTCCAGGTGGGGAAGGTGGGAGG - Intronic
1063623226 10:7667275-7667297 GTCCAGGAGGGGACGCAGGGTGG - Intergenic
1064273593 10:13886687-13886709 CTCCAGGAGGCTAAAATGGGAGG - Intronic
1065433384 10:25682353-25682375 TTCCAGGAGGGGAGGTAGGGTGG + Intergenic
1067851295 10:49756316-49756338 CTCCAGGAGGAGCAACTGGTGGG + Intronic
1069711465 10:70491745-70491767 CTGGGGGAGGGGAAACTGGGAGG - Intronic
1069738996 10:70675568-70675590 CTCTGGGAGGAGAGACAGGGAGG - Intronic
1070744884 10:78927653-78927675 CCCCAGGAAGGGAGACCAGGAGG + Intergenic
1070793423 10:79203158-79203180 CTCAAGGAGGGAAGGCTGGGTGG - Intronic
1071495138 10:86162885-86162907 CTCCAGGAGGGCAGCCTGGCAGG + Intronic
1072662199 10:97370009-97370031 CCGCAGGAAGGGAGACAGGGAGG + Intronic
1072725042 10:97807481-97807503 CTCCAGGAGGGGCCACTCAGGGG + Intergenic
1073043604 10:100623398-100623420 ATCCAGCAGGGGACAATGGGAGG - Intergenic
1073076592 10:100828468-100828490 TGGCAGGAGGGGAAACTGGGAGG - Exonic
1073178418 10:101570107-101570129 CTCCCGGCGGGGTGACGGGGAGG + Intergenic
1073484173 10:103806199-103806221 GTCCAGGGGGGTAGGCTGGGGGG - Intronic
1073957650 10:108891379-108891401 CTCCAGGAGGGAAGGCAGGGTGG + Intergenic
1074692885 10:116022530-116022552 CTCCAGAAGGACAGACTCGGAGG + Intergenic
1075595191 10:123724079-123724101 CTCCTGGCAGGGAGGCTGGGTGG - Intronic
1075831960 10:125419418-125419440 CTCCAGGAGGAGACAGGGGGCGG + Intergenic
1076252428 10:128995079-128995101 CTCCAAGAGAGGTGGCTGGGGGG + Intergenic
1076503359 10:130954561-130954583 ATCCAGCAGAGGAGACTGAGAGG - Intergenic
1076846398 10:133071499-133071521 CCCGAGGAGGGGAGAAAGGGAGG - Intronic
1077430267 11:2512766-2512788 CTCCAGGCGGGCAGACAGGCAGG - Intronic
1077462315 11:2716739-2716761 CTTCAGGAGGTGGAACTGGGTGG + Intronic
1077630760 11:3809583-3809605 CTTCAGGGAGGGATACTGGGAGG + Intronic
1077899250 11:6476469-6476491 CTCTAGGAGGGTGGCCTGGGTGG - Exonic
1079076645 11:17388889-17388911 CACCTGGAGGAGAGACGGGGCGG - Intronic
1079339628 11:19601383-19601405 GTCCAGGAGGGGAGGCCGGAGGG - Intronic
1080437204 11:32256048-32256070 CTCCAGTGGGGGAGATTTGGTGG - Intergenic
1081537490 11:44006137-44006159 TCCCAGGAGGGGTGACTGTGTGG + Intergenic
1081739284 11:45426920-45426942 CTCCAGGAGGCGAGACCTGCTGG + Intergenic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082171849 11:49014349-49014371 ATACAGGAAGGGAGACTAGGAGG - Intergenic
1082265195 11:50110369-50110391 CTCCAGCCTGGGAGCCTGGGTGG + Intergenic
1082802433 11:57424989-57425011 TGACTGGAGGGGAGACTGGGGGG - Intronic
1082911156 11:58375926-58375948 CTCCAGCCAGGGACACTGGGGGG - Intergenic
1083204118 11:61137750-61137772 CTCCTGGTGGGGAGATTGTGAGG - Intronic
1083345068 11:61983749-61983771 TTCCAGCTGGGGAGACTGGAGGG + Intergenic
1084189871 11:67494068-67494090 CACCTGGAGGGGAGAAGGGGCGG + Exonic
1084670999 11:70606629-70606651 GCCCAGGAGGGGAGTCTGAGGGG - Intronic
1085122039 11:73973551-73973573 TTCAAGGAGTGGAGACTGTGAGG - Intergenic
1086693916 11:89821604-89821626 ATACAGGAAGGGAGACTAGGAGG + Intergenic
1086712229 11:90022965-90022987 ATACAGGAAGGGAGACTAGGAGG - Intergenic
1087093447 11:94298563-94298585 CTCCAGGCAGGGTGACTGGAGGG + Intergenic
1089055578 11:115582232-115582254 CTGGAGGTGGGGAGGCTGGGTGG + Intergenic
1089493423 11:118897132-118897154 CTCAGGGAGTGGAGACTGGAGGG + Exonic
1089645549 11:119876355-119876377 CTCCAGGAGAGAAGCCTGTGGGG - Intergenic
1089827583 11:121292811-121292833 CTCCAGGTGGGGACGGTGGGTGG + Exonic
1090657322 11:128856022-128856044 CTCCAGGAGGGGATGAGGGGAGG - Intronic
1091277927 11:134364823-134364845 CTCCAGGTGCGGAGAGAGGGAGG + Intronic
1091386577 12:99807-99829 CTCCAGGAAGCGGGACAGGGAGG - Intronic
1092101218 12:5885157-5885179 CCCCAGGAGTGGGGACGGGGTGG - Intronic
1092256388 12:6928467-6928489 CGGCAGGAGGGGGAACTGGGAGG - Intronic
1092461697 12:8692818-8692840 CTCCAGGAGAGGAAACAGTGGGG + Intronic
1092932555 12:13330169-13330191 TTCCAGGATGGGAGAGAGGGAGG - Intergenic
1095497420 12:42799522-42799544 CTGGAGGAAGGGAGAATGGGAGG - Intergenic
1095948433 12:47767072-47767094 CTGCAGGAGGGGGGCCTGGGTGG + Intronic
1096189214 12:49604261-49604283 CTCTGGGAGGGGAGTGTGGGTGG - Intronic
1096500794 12:52062902-52062924 CCCCAGGATGGGAGACTGTCTGG + Intergenic
1096554442 12:52394832-52394854 CTCAAGGAGGGAACACTGGAGGG + Exonic
1096683509 12:53272658-53272680 CTCCAGGAGGAGAGGGTGGTGGG + Intronic
1099365144 12:81758953-81758975 CTCCAGGAGGGGAGACTGGGTGG - Intronic
1102458144 12:113083812-113083834 GTCCAGGAGGGGAGAGAAGGAGG - Intronic
1103362280 12:120361483-120361505 CCCCAGGAGGGGACACCGGTGGG - Intronic
1104373494 12:128244274-128244296 CTCCAGGAGCTGAGAGTGAGAGG - Intergenic
1104953122 12:132451309-132451331 CAGCAGGAGGGGAGACTGGGAGG - Intergenic
1105906578 13:24816708-24816730 CTCCAGGAGTGCTGACTGGGAGG - Intronic
1105946961 13:25198377-25198399 CTCCAGGTGGGAGAACTGGGTGG + Intergenic
1108683807 13:52802139-52802161 CTCCAGCCTGGGAGACAGGGTGG - Intergenic
1109280449 13:60349610-60349632 AGCCAGGAGGGGAGTCGGGGCGG + Intergenic
1109845795 13:67989067-67989089 CTGCAGGAGTGGAGACAGTGTGG - Intergenic
1110102665 13:71629219-71629241 CTCCTGGAGGGAAGACAGGGAGG - Intronic
1110586390 13:77198752-77198774 CCCCAGGAGTGGAGACCGGGAGG - Intronic
1112460625 13:99600670-99600692 TGCCAGGAGGTGAGGCTGGGAGG + Intergenic
1113323102 13:109256379-109256401 CTATCAGAGGGGAGACTGGGAGG + Intergenic
1113675233 13:112202456-112202478 CTCCTGGAGGGGACACTGAAGGG + Intergenic
1113840465 13:113356891-113356913 CTCCTGGAAGGGAACCTGGGAGG + Intronic
1113905318 13:113816827-113816849 CTCCACGAGGGGAGAGGGGGAGG - Exonic
1115985834 14:39103040-39103062 CCCCAGGAGCGGAGACGAGGCGG + Exonic
1116232071 14:42229733-42229755 CTCATGGAGAGGAGACTGAGGGG - Intergenic
1117377941 14:55132597-55132619 CTCCAGCCTGGGAGACTGCGAGG - Intronic
1118266065 14:64295651-64295673 CCCCAGGACAGGAGACAGGGAGG - Intronic
1119094076 14:71812725-71812747 GTCCAGGTGTGGAGGCTGGGTGG + Intergenic
1119471264 14:74901169-74901191 CCCCAGGATGGCAGACTGAGGGG - Exonic
1121435552 14:93916931-93916953 GGGGAGGAGGGGAGACTGGGAGG - Intergenic
1121578264 14:95006664-95006686 CAGCAGGAGAGGAGGCTGGGGGG + Intergenic
1122088861 14:99324988-99325010 TTCCAGGACGGGAGACAGGGAGG - Intergenic
1122167270 14:99837244-99837266 TTCCAGGATGTGAGACAGGGAGG - Intronic
1122230386 14:100303975-100303997 CCCCAGTAGGGGAGAGGGGGAGG + Intronic
1122249376 14:100427320-100427342 CTGCAAGAGAGGAGACTGAGAGG - Intronic
1122565849 14:102655245-102655267 CTCCAGGAAGGGAAAATGGAAGG - Intronic
1123121832 14:105920313-105920335 AGCCAGGTGGGGAGACTGTGAGG + Intronic
1123404525 15:20011964-20011986 AGCCAGGTGGGGAGACTGTGAGG + Intergenic
1123513858 15:21018611-21018633 AGCCAGGTGGGGAGACTGTGAGG + Intergenic
1124704816 15:31954751-31954773 GGCCAGGAGGGCAGAGTGGGTGG + Intergenic
1125845317 15:42846806-42846828 CTCCAGGAAAGGTGAGTGGGAGG + Intronic
1127850099 15:62904738-62904760 GTGCAGGAGGGGAGACTGGGAGG + Intergenic
1128247668 15:66144041-66144063 CTCCAGGTGGGGATATAGGGAGG + Intronic
1128327383 15:66733876-66733898 CTGCAGGATGGGAGATTTGGAGG + Intronic
1128712457 15:69882535-69882557 CTCCAGGAGCTGAGACTGTAAGG + Intergenic
1128885109 15:71279569-71279591 CTCCAGGAGGGAAGTGTGGAGGG + Intronic
1129114458 15:73357537-73357559 CCCTAGGAGGGGAGGCTGGGAGG + Intronic
1129390087 15:75216037-75216059 CTCCAGAAGGGGACCCTGGGGGG - Intergenic
1129618523 15:77120849-77120871 CACCTGGAGGGTAGAGTGGGTGG - Intronic
1130219961 15:82011171-82011193 CTTCAGGAGGTGAGGCAGGGAGG - Intergenic
1130380738 15:83370681-83370703 CTCCAGAATTTGAGACTGGGAGG - Intergenic
1131302355 15:91210694-91210716 CTCCAATAGGGGACACTGGCTGG - Intronic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1132466807 16:81378-81400 CTCCATGGGGGCACACTGGGGGG - Intronic
1132903767 16:2271912-2271934 CTCCAGGAGGTAGGACGGGGTGG - Intergenic
1133888141 16:9851138-9851160 CACCAGGAGAGGTGACAGGGTGG + Intronic
1134851894 16:17485557-17485579 CTCCAGGAGGCTAAAGTGGGAGG + Intergenic
1135411254 16:22236296-22236318 CTGCAGGAGGGGAGAGTAGTTGG + Intronic
1136232911 16:28897980-28898002 CACCTGGAGAGGAGACAGGGAGG - Exonic
1136282335 16:29221104-29221126 CTGCAGGTGGGGCGGCTGGGAGG + Intergenic
1137647339 16:50087605-50087627 CTCCAGCAATGGATACTGGGTGG - Intronic
1137707033 16:50542698-50542720 CTCCAGGAGCCTAGACTGGGAGG - Intergenic
1138912910 16:61424518-61424540 CCTCAGGAAGGGAGACAGGGAGG - Intergenic
1139276434 16:65732053-65732075 CAACAGGAGTTGAGACTGGGTGG + Intergenic
1139845673 16:69919557-69919579 CTCCAGCAGGTGGAACTGGGAGG - Intronic
1139917934 16:70439414-70439436 GTGCAGGAGGGGAGACGGAGGGG + Intergenic
1139933022 16:70545094-70545116 CTCCAGCATGGGAGACAGAGTGG - Intronic
1140519938 16:75572302-75572324 CTCCAGCAGGGCAGGATGGGTGG - Intronic
1141710657 16:85697105-85697127 CTCCAGGAAGGGAGGTTGGGAGG - Intronic
1141731808 16:85827963-85827985 CTCCACGAGCAGAGATTGGGCGG - Intergenic
1141904861 16:87017802-87017824 GCCCAGGAGAGGAGGCTGGGAGG - Intergenic
1142086707 16:88187022-88187044 CTGCAGGTGGGGCGGCTGGGAGG + Intergenic
1142472153 17:170500-170522 CTGCAGGTTGGGAGGCTGGGTGG + Intronic
1142758532 17:2029779-2029801 TACCAGGAGGGGAGACTGGCAGG + Intergenic
1143526795 17:7477859-7477881 CACCCGGAGGAGAGGCTGGGCGG - Intronic
1143619377 17:8072370-8072392 GTCCAGGAGGGGAGACCGAAAGG - Intergenic
1144106425 17:11990519-11990541 CTCCAGTCGGGCAGGCTGGGAGG + Exonic
1144836525 17:18159267-18159289 TTCCTGGAGGGGAGTCTGTGGGG - Exonic
1144890203 17:18490013-18490035 CTCAAGCAGTGGGGACTGGGAGG + Intronic
1145097857 17:20046961-20046983 CTCCAGGGGACAAGACTGGGAGG + Intronic
1145142013 17:20454305-20454327 CTCAAGCAGTGGGGACTGGGAGG - Intronic
1145793892 17:27644594-27644616 CTCAAGTAGTGGGGACTGGGAGG + Intronic
1145808698 17:27752147-27752169 CTCCAGTAGTGGGGACTGGGAGG + Intergenic
1146260021 17:31415011-31415033 CTCCAGCAGGGGAAGCAGGGAGG + Intronic
1146449506 17:32961225-32961247 CTCCAGGAGCAGCGCCTGGGAGG - Intergenic
1146493548 17:33300130-33300152 CTCCAGGGAGGAAAACTGGGTGG - Intronic
1147362017 17:39936783-39936805 CTCCAGGCTGGGAGACAGAGTGG + Intergenic
1147403227 17:40193246-40193268 CTCCAGAATTGGAGACTGGAGGG + Intronic
1147564291 17:41527287-41527309 CCCCAGGGCGGGAGAGTGGGAGG + Intronic
1147947175 17:44086735-44086757 CAGCTGGAGGGGAGAATGGGAGG + Exonic
1148763559 17:50022320-50022342 CTCCAGAGGGAGAGACTGGTAGG - Intergenic
1148776884 17:50101009-50101031 CTCCAGGCGTGGAGTCTGTGGGG + Intronic
1148808178 17:50274562-50274584 CCCCAAAAGGTGAGACTGGGAGG + Exonic
1149663869 17:58352311-58352333 CAGCAGGCGGGGAGGCTGGGCGG + Intronic
1150021718 17:61621830-61621852 CTGCTGAAGGGGAGACTAGGTGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151328560 17:73393576-73393598 CTCCAGGATGGGAGGGTGGCTGG + Exonic
1151421562 17:74001456-74001478 CTCCAGGAGTGAAGACTTTGGGG + Intergenic
1153680571 18:7496944-7496966 CTCGAGGAGGGGGAACTGGGTGG - Intergenic
1155172973 18:23280843-23280865 CTCCAGAAGAGGAGACGGGGGGG - Intronic
1156474428 18:37396826-37396848 CTCTAGGAGGGCTGTCTGGGAGG - Intronic
1156653675 18:39257001-39257023 CTCCAGCATGGGTGACTGGGTGG + Intergenic
1157273605 18:46294752-46294774 CTCCAGGAGTGGGGGGTGGGGGG - Intergenic
1157327818 18:46681498-46681520 CCCCAGGAGGGGAGCCAGGAGGG + Intronic
1160152807 18:76407773-76407795 CCCCATGAGGGGTGTCTGGGTGG - Intronic
1160325263 18:77940759-77940781 CTCCAGGCTGGGAGGCTGCGCGG + Intergenic
1160387572 18:78505737-78505759 CTCCGGGTGGGGAGAATGAGGGG - Intergenic
1160442722 18:78904480-78904502 CTCCAGGAGTGAGGACTGGGGGG + Intergenic
1160927660 19:1554617-1554639 CACCAGGAGGGGAGACCCCGGGG - Intergenic
1161383228 19:3977452-3977474 CTCCATGAGGCGTGGCTGGGCGG + Exonic
1161569507 19:5022819-5022841 CTCCAGGTGGGGGGGCTTGGAGG + Intronic
1161664720 19:5568238-5568260 CTCCAGGGAGGGAGGCTGGGAGG + Intergenic
1161675764 19:5647800-5647822 CTCCTGCAGGGGAGACTGAATGG + Intronic
1162067232 19:8133188-8133210 CTCCAGGGAGGGATCCTGGGGGG - Intronic
1162081129 19:8218516-8218538 CTGCGGGAGGGCAGACAGGGAGG + Intronic
1162131810 19:8530559-8530581 CTCCAGGAGGAAAAGCTGGGCGG + Exonic
1162165056 19:8746866-8746888 TTCCATGTGGGGAGACAGGGAGG + Intergenic
1162166122 19:8754317-8754339 TTCCATGTGGGGAGACAGGGAGG + Intergenic
1162167188 19:8761773-8761795 TTCCATGTGGGGAGACAGGGAGG + Intergenic
1162169197 19:8775529-8775551 TTCCATGTGGGGAGACAGGGAGG + Intergenic
1162169877 19:8780840-8780862 TTCCATGTGGGGAGACAGGGAGG + Intergenic
1162170940 19:8788299-8788321 TTCCATGTGGGGAGACAGGGAGG + Intergenic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163020744 19:14479751-14479773 ATGCTGGAGGGGAGACTGGAGGG + Intronic
1163125968 19:15244385-15244407 CTCCAGGACGGGCACCTGGGTGG + Exonic
1163241978 19:16070028-16070050 CTGCTGCAGGGGTGACTGGGTGG + Intronic
1163256165 19:16157305-16157327 CTCCAAGAGGGGATTTTGGGGGG - Exonic
1163405490 19:17119470-17119492 GCCGAGGAGGGGAGCCTGGGCGG + Intronic
1164680093 19:30128432-30128454 CTCCATGAGGGGACGGTGGGTGG - Intergenic
1165470844 19:36003622-36003644 CTCCAGGATGTGAGGCTGGAGGG - Exonic
1165610959 19:37152030-37152052 CACCAGGAGCTGAGACTTGGAGG + Exonic
1165614327 19:37185668-37185690 CACCAGGAGCTGAGACTTGGAGG + Exonic
1165685571 19:37817196-37817218 CCCCAGGAGGCGAGTCTGAGTGG - Intronic
1166105932 19:40598115-40598137 CGCCAGGCGGGGAGGGTGGGTGG - Intronic
1166301228 19:41913139-41913161 CTGCGGGAGGAGAGGCTGGGAGG - Intronic
1166348981 19:42185302-42185324 GGGCAAGAGGGGAGACTGGGAGG - Intronic
1166364853 19:42273113-42273135 TGCCAGGAGGGGAGCCAGGGCGG + Intronic
1166531965 19:43548127-43548149 CTCCTGGAGGGGCGGCTGGCCGG - Intronic
1166679823 19:44759458-44759480 GTCCCTGGGGGGAGACTGGGAGG - Exonic
1167245942 19:48373269-48373291 CTGGAGGTGGGGAGGCTGGGAGG + Intronic
1167705612 19:51079374-51079396 CTCCAGGAGGTGGAGCTGGGGGG - Intronic
1167885009 19:52493189-52493211 CTCCAGGGGCCGAGCCTGGGAGG - Intronic
1168524024 19:57074535-57074557 CTGCAGGGGGAGAGAGTGGGCGG - Intergenic
925098260 2:1224535-1224557 CTCCAGGTGAGGGGCCTGGGAGG - Intronic
925146702 2:1587276-1587298 GACCAGGTGGGGAGACCGGGTGG + Intergenic
925308036 2:2864036-2864058 CTTCAGGAGTGCAGACTTGGAGG - Intergenic
925927449 2:8680418-8680440 CTCCAGGGAGGCAGAGTGGGTGG - Intronic
926165655 2:10521131-10521153 GGCCAGGAGGGGAGGCTGGAGGG + Intergenic
926856912 2:17266779-17266801 CAACAGCAGGGCAGACTGGGAGG + Intergenic
927971432 2:27308067-27308089 CTCCGGGGAGGGAGGCTGGGTGG - Intronic
928175146 2:29028331-29028353 TTGCAGCAGGGGAGAATGGGAGG - Intronic
928401124 2:30979459-30979481 ATCAAGGAGGAGAGACAGGGAGG + Intronic
929543607 2:42841444-42841466 ACCCAGGAGGGGACTCTGGGGGG - Intergenic
929898169 2:45979373-45979395 CTTCAGGGAGGGAGACAGGGAGG - Intronic
931159468 2:59673040-59673062 CTTCAGGAGAGGAGACTACGAGG + Intergenic
931238536 2:60432517-60432539 ACCCAGGAGGGGCGTCTGGGAGG - Intergenic
932430767 2:71672510-71672532 CTCCAGGTGGGGAGCCTGGCCGG - Intronic
933274182 2:80266282-80266304 CTCCATGTGAGGAGGCTGGGTGG + Intronic
934037198 2:88098140-88098162 CTCCAGGAGGGAAGGCTGACTGG - Intronic
935371863 2:102355925-102355947 CTCCACGCGGGGCGTCTGGGTGG + Exonic
937316053 2:120932794-120932816 CGGCAGGCTGGGAGACTGGGTGG + Intronic
937890953 2:126938309-126938331 CTCCAGGCTGGGATAATGGGAGG - Intergenic
943166987 2:184341924-184341946 TACCAGGAGTGGAGACTGGGAGG - Intergenic
943622528 2:190165693-190165715 TTCCAGGAGGAGAGAATGAGGGG + Intronic
944545329 2:200793474-200793496 CTTCAGGAGGCCAGAATGGGAGG + Intergenic
945031230 2:205665527-205665549 ATCCATCAGAGGAGACTGGGTGG - Intergenic
945984083 2:216340397-216340419 CTGCAGGAGGAGAGCCAGGGAGG - Intronic
946322989 2:218964413-218964435 TTCCAGGAAGGGGGACAGGGAGG - Intergenic
946651003 2:221892382-221892404 CTCCCGGACGGGAGGCTGGCCGG - Intergenic
946777405 2:223157717-223157739 CTCCAGGCTGGGAGACAGAGTGG + Intronic
946891154 2:224278411-224278433 CTCCATGAGTAGAGACTGTGGGG - Intergenic
947152080 2:227125876-227125898 CTCCAGGAGCAGAGGTTGGGTGG - Intronic
947395802 2:229685910-229685932 CTTCAGGAGGGGAGGCTTAGTGG + Intronic
947605749 2:231484096-231484118 CCGCAGGAAGGGACACTGGGAGG - Intergenic
948382568 2:237561022-237561044 CTCCAGGAGGGTAGCATGGCAGG + Intergenic
948484565 2:238272277-238272299 GTCCAGGCTGGGTGACTGGGAGG + Intronic
948759767 2:240183352-240183374 CTGCAGGATGGGAGCCTGGGAGG + Intergenic
1169141100 20:3227985-3228007 GTCTAGGAGTGGAGAGTGGGTGG - Intronic
1170100056 20:12689014-12689036 CTCCAGGAGGGAAGACTTCCTGG - Intergenic
1170576481 20:17665748-17665770 CTCCAGGAAGCGACCCTGGGTGG - Intronic
1171012008 20:21513979-21514001 CTCCAGGAGGGGTGCCAAGGCGG + Exonic
1171437366 20:25133800-25133822 TTCCAGGAGGGCAGGCTGGAGGG - Intergenic
1171768242 20:29301638-29301660 CCCGAGGAGGGGCGACTGGCGGG - Intergenic
1172697535 20:36832868-36832890 CTCCAGGCAGCCAGACTGGGAGG + Intronic
1172840309 20:37898965-37898987 CTCAAGGAGGGGAGGGAGGGTGG + Intergenic
1173551139 20:43933907-43933929 CTTGAGGAGGGTGGACTGGGAGG + Intronic
1173643946 20:44622126-44622148 CTCCAGGATGGGAGCCAGGCAGG + Intronic
1173886426 20:46463213-46463235 CTCCAGCCAGGGAGCCTGGGTGG + Intergenic
1173923095 20:46760579-46760601 CCCCAGGGGGCGAGCCTGGGTGG + Intergenic
1174043232 20:47714754-47714776 CCCCAGGACAGGAGGCTGGGGGG - Intronic
1174165751 20:48582491-48582513 GCCCAGGAGGGAAGCCTGGGAGG + Intergenic
1174444756 20:50583021-50583043 CTCCAGGAGGGAGCCCTGGGTGG - Exonic
1174781551 20:53393790-53393812 CTCCACGGGGAGAAACTGGGAGG + Intronic
1175962288 20:62643114-62643136 CTCCGGGAGGGGAGCGCGGGCGG + Exonic
1176019996 20:62957618-62957640 CACCAGGTGGGGAGACAAGGGGG + Intronic
1176030732 20:63009940-63009962 CACCAGGAGGTCAGGCTGGGTGG + Intergenic
1179601102 21:42477283-42477305 CTCCAGGAGCTGAGAGTGTGGGG - Exonic
1179630572 21:42675723-42675745 TCCCAGTAGGGGAGACTGGGTGG - Intronic
1179709729 21:43206394-43206416 CTGCAGGAAGGGCCACTGGGTGG + Intergenic
1179879364 21:44287043-44287065 CTCTTGGTGGGGAGTCTGGGTGG - Exonic
1180178992 21:46109597-46109619 GTGCAGGAGGGGAGGCTTGGGGG - Intronic
1180185227 21:46135914-46135936 GCCGGGGAGGGGAGACTGGGAGG - Intergenic
1180244594 21:46538633-46538655 TTGCAGGAGGGGACACTGTGTGG - Intronic
1180800973 22:18631764-18631786 CCCCAGGAGGAGTGACAGGGAGG - Intergenic
1180814649 22:18781888-18781910 CTCCCGGAAGGGACACTAGGAGG - Intergenic
1181058859 22:20272517-20272539 CTCCAGGATGGGAGCCTGAACGG + Intronic
1181200838 22:21216224-21216246 CTCCCGGAAGGGACACTAGGAGG - Intronic
1181220745 22:21363498-21363520 CCCCAGGAGGAGTGACAGGGAGG + Intergenic
1181648339 22:24245781-24245803 CTCCAGGGAGGGAGGCTGTGTGG + Intergenic
1181777253 22:25168659-25168681 CTCCAGCCTGGGAGACAGGGTGG + Intronic
1182298658 22:29326110-29326132 CTCCAAGAGGCGAGACGGGGAGG + Intergenic
1182620507 22:31616091-31616113 CTCCAAGCAGGGAGCCTGGGTGG + Intronic
1183059371 22:35326801-35326823 CTCTAGGAGGAGAGAGAGGGGGG + Intronic
1183987255 22:41576443-41576465 CCACAGGAGGGGAGCCTTGGGGG - Exonic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184371168 22:44082992-44083014 CCCCAGGAGGTGAGGCTGGGGGG + Intronic
1184607061 22:45580252-45580274 CTCCTGGTGGGGAGCGTGGGAGG + Intronic
1185381188 22:50508086-50508108 CTCCGGGAGGGGGGGGTGGGCGG - Intergenic
1203226081 22_KI270731v1_random:79211-79233 CTCCCGGAAGGGACACTAGGAGG + Intergenic
1203264746 22_KI270734v1_random:7575-7597 CTCCCGGAAGGGACACTAGGAGG - Intergenic
949941337 3:9157163-9157185 ATACAGGAGGCGTGACTGGGAGG + Intronic
950080228 3:10216666-10216688 CTCCAGAAACGGAGACTGAGAGG - Intronic
950172811 3:10851217-10851239 CTCCAGGAGCAGTGACTGGGAGG + Intronic
950422022 3:12904857-12904879 CTCCAGGTGGGGACACTATGTGG - Intronic
950708176 3:14796661-14796683 CTCCAGGAGAGGAGAAGGGGAGG - Intergenic
951030033 3:17871176-17871198 CCAAAAGAGGGGAGACTGGGAGG - Intronic
951990738 3:28673682-28673704 CTAAAGGAGGTCAGACTGGGTGG + Intergenic
952728727 3:36617289-36617311 CTCCAGAAGGAGAGAGTGAGAGG + Intergenic
952801737 3:37299096-37299118 CTCCGGGAGAGGAGAGTGGATGG + Intronic
952888348 3:38025146-38025168 GCCCAGGAGGCGAGCCTGGGAGG + Intronic
953420776 3:42751665-42751687 CTCCAGAAAGGAAGGCTGGGAGG - Intronic
954126551 3:48534280-48534302 GTCCAGGATGGGAGAAGGGGTGG + Intronic
954195048 3:48991344-48991366 CTCCAGTGGAGGAGGCTGGGGGG - Intronic
954391412 3:50269850-50269872 CTCCAGGCGGGCGCACTGGGAGG - Intronic
954465861 3:50654414-50654436 CACCTGGAAGGGAGACTGGTTGG - Intergenic
960926058 3:122795559-122795581 CTCCCGGAGGAGAGACAGCGCGG - Intronic
961400736 3:126640448-126640470 ATACAGGAAGAGAGACTGGGGGG - Intronic
962167667 3:133066805-133066827 CTCTAGTAGGGGAGAGAGGGAGG - Intronic
962204873 3:133426145-133426167 CTCCAAGAGGGGAGTCTAAGAGG - Intronic
962426490 3:135273205-135273227 CTCCACGTGGTGAGACTGGGTGG - Intergenic
962538192 3:136350436-136350458 CCCCAGGAGTGGAGACTTGGTGG - Intronic
962713031 3:138103436-138103458 CACCAGGCAGGGAGAGTGGGAGG - Intronic
966868622 3:184276211-184276233 CTCCACGGGAGGGGACTGGGTGG + Intronic
968660382 4:1796360-1796382 CTCCAGGTGGGGAGACAGGGAGG + Intronic
968671630 4:1855485-1855507 GTCCCGGAGACGAGACTGGGTGG - Intronic
968929227 4:3569568-3569590 CACCAGGTGGGAGGACTGGGTGG + Intergenic
969110969 4:4844081-4844103 CTCCAGGAGGGGTGGCTGCTGGG - Intergenic
969198829 4:5585358-5585380 TTTCAGGAAGGGAGAATGGGAGG - Intronic
969231606 4:5835751-5835773 CTCCAGTTGGAGAGATTGGGAGG - Intronic
970507414 4:16745322-16745344 GCCCAGGCGGGGAGACTGCGGGG + Intronic
970567413 4:17346175-17346197 TTTCAGGAAGGGAAACTGGGTGG - Intergenic
970746674 4:19306457-19306479 CTACAGGGGGCGAGAATGGGAGG + Intergenic
971486679 4:27167897-27167919 CTCGAGGATGAGAGACTGTGAGG - Intergenic
972624843 4:40786798-40786820 ATCCAGGAGGGCAGACAGGCAGG - Intronic
973536184 4:51884773-51884795 CTGCAGGTGGGGAGATTGTGAGG + Intronic
973613101 4:52656400-52656422 CTCTGGGAAGGAAGACTGGGAGG + Intronic
975765912 4:77667401-77667423 CTGCAGGAGTGGAGACTGGAAGG - Intergenic
975991332 4:80262928-80262950 CTCCAGGAGTGGAGATTTTGGGG + Intergenic
976348394 4:84031285-84031307 ATCCAGGAATGGAGAGTGGGGGG - Intergenic
981229754 4:142338951-142338973 GTCCAGGAGGGGAGAACGGAGGG + Intronic
981376425 4:144021497-144021519 CTGCAGGAAAGGAGAGTGGGAGG - Intergenic
985163320 4:187066143-187066165 CTCCAGGCAGGGGGACTGGACGG - Intergenic
985815652 5:2125960-2125982 ATACAGGTGGGGAGACTGGGCGG + Intergenic
985841676 5:2310524-2310546 GACCAGGATGGGAGACTAGGAGG + Intergenic
988519353 5:31931857-31931879 CTCCAGGAGGGCTGGATGGGAGG + Intronic
990866930 5:60390160-60390182 CTCCAGCAGGGGAGGAAGGGAGG - Intronic
992978411 5:82140567-82140589 CTCCCGGAGGGGCGGCTGGCCGG - Intronic
993307742 5:86291901-86291923 CTCCAGGAGGAGATACTGAGTGG - Intergenic
994180958 5:96765527-96765549 CTCCCTGAGGGGATTCTGGGAGG + Intronic
997370434 5:133356393-133356415 CTCTAGGAGGAGGTACTGGGAGG + Intronic
998093494 5:139384176-139384198 TGCCAGGAGGGGAGACAGGCTGG - Intronic
998134802 5:139668956-139668978 CCCCAAGAGAGGAGACTGGGAGG - Intronic
998164764 5:139836721-139836743 CTCCTGGAGAGGAGGCTGGTGGG + Intronic
998503484 5:142653465-142653487 AGCTAGAAGGGGAGACTGGGAGG - Intronic
998719541 5:144928407-144928429 CTTTAGGAGGCCAGACTGGGAGG + Intergenic
999359585 5:150971883-150971905 CTCTAGGAGTGGAGGCTGGGAGG - Intergenic
999685145 5:154096140-154096162 CTAAGGGAGGGGACACTGGGTGG - Intronic
1000211036 5:159105990-159106012 TTCTCAGAGGGGAGACTGGGAGG + Intergenic
1001645077 5:173274354-173274376 CTCCAGCCTGGGAGACAGGGTGG + Intergenic
1002026817 5:176401384-176401406 CTCAAGGAGTGGGGATTGGGTGG - Intronic
1003938701 6:11002507-11002529 ATCAAAGAGAGGAGACTGGGTGG + Intronic
1004232733 6:13847715-13847737 TTCCAGGAGGGGTGGGTGGGAGG - Intergenic
1005314188 6:24588379-24588401 GTCCAGGAGAGGAGACTGGCAGG - Intronic
1005375624 6:25179535-25179557 TTCCAGGAAAGGACACTGGGAGG - Intergenic
1006091754 6:31632507-31632529 GTCCAGGAGCGGAGGCTGGAAGG - Exonic
1006093569 6:31642307-31642329 CACCAGAAGGGGAGCCTGGTGGG + Exonic
1006416058 6:33904569-33904591 CCCCGGGAGGGGTGGCTGGGGGG - Intergenic
1006811137 6:36821304-36821326 CACAAGGTGGGGGGACTGGGAGG + Intronic
1006813578 6:36836602-36836624 CTCCAGGAGAGGAGGCTCTGGGG - Intronic
1007325386 6:41055510-41055532 CTCCAGGAGGGAGTCCTGGGGGG - Intronic
1009289744 6:61868138-61868160 CTCAAGCAGGGGTGGCTGGGAGG + Intronic
1010032511 6:71286325-71286347 ATCCAGCAGGGGATACTGGAAGG + Intergenic
1012758506 6:103264278-103264300 CTGCAGGAGCGAAGTCTGGGAGG - Intergenic
1015486826 6:133781102-133781124 TTCCGTCAGGGGAGACTGGGAGG - Intergenic
1017512976 6:155130448-155130470 CTCCAGGTGGGGAAACTGTGGGG - Intronic
1017806729 6:157952898-157952920 CTCCAGGTGGGGACAGTGAGTGG - Intergenic
1018245247 6:161816337-161816359 CTCCAGGAGATGAGAAGGGGAGG + Intronic
1019028005 6:168988009-168988031 CTGCAGGAGAGGAAACTTGGTGG + Intergenic
1019265515 7:115339-115361 GTCCAGAAGGGGAAACTTGGCGG - Intergenic
1019302212 7:311593-311615 CTCCAGGAGGGGGGCGGGGGTGG - Intergenic
1019517557 7:1446547-1446569 CGGGAGGAGGGGAGACGGGGAGG + Intronic
1019517642 7:1446864-1446886 CACCAGGAGGGAGGGCTGGGTGG - Intronic
1019616598 7:1965774-1965796 CTGCAGGAGGGAGGACAGGGAGG - Intronic
1025978418 7:66387929-66387951 CTCCAGGAGGCAAGACGGGCTGG + Intronic
1026807478 7:73437086-73437108 CTCCAGGAGGGGAGACGCTCAGG + Intergenic
1027203998 7:76082600-76082622 CTCCAGGAGGCAAGACTGGCTGG + Intergenic
1028545731 7:91997657-91997679 TTCCAGGAGGTAAGAGTGGGAGG + Intronic
1029259067 7:99289167-99289189 CTCCAGGCAGGTAGCCTGGGAGG + Intergenic
1029424065 7:100485785-100485807 CCCCAGCAGGGAAAACTGGGAGG - Intronic
1029424636 7:100488261-100488283 CTCGAGGAGAGGGGCCTGGGGGG - Exonic
1029690133 7:102175674-102175696 CCACAGGAGGGGGGAATGGGTGG - Intronic
1033655191 7:143368533-143368555 TCCCAGCAGGGGAGACAGGGAGG - Intergenic
1034071861 7:148193880-148193902 CTCCACATGGGGAGAGTGGGAGG - Intronic
1034269148 7:149795289-149795311 CCCCAGGAGGGCAGCCTGGGTGG - Intergenic
1034903133 7:154920233-154920255 CCCCAGGAAGGGGGACTGGAAGG + Intergenic
1034954261 7:155324535-155324557 CACCAGGAGGGGAGATTAGGTGG - Intergenic
1035263138 7:157674292-157674314 CCCCAGGAGGCGAGGGTGGGGGG + Intronic
1036088327 8:5637492-5637514 CTCCAGGAGACCAGCCTGGGGGG + Intergenic
1037722324 8:21455410-21455432 CTCCAGGAGGAGAGCAGGGGAGG - Intergenic
1037882597 8:22580244-22580266 GTGGAGGAGGGGAGACTGAGGGG + Intronic
1037904141 8:22705402-22705424 ATGGAGGAGGGGGGACTGGGAGG - Intergenic
1038363556 8:26907736-26907758 CTCCATGAGGTGAAACTGGAGGG + Intergenic
1039090302 8:33820907-33820929 GTCCAGGAGAGGGGGCTGGGAGG + Intergenic
1039568500 8:38567583-38567605 CTCAAGGAGGTGAGGCTGGTCGG - Intergenic
1041286424 8:56266504-56266526 CTCTTGGATGGGAGCCTGGGTGG + Intergenic
1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG + Intergenic
1044360974 8:91283261-91283283 GTCCAGGAGGGGAGAGAGGGAGG + Intronic
1045281603 8:100754260-100754282 TTCCAGCAAGGGAGCCTGGGTGG - Intergenic
1045326170 8:101119356-101119378 CTCCATGCGGGGAGCCTGGCAGG - Intergenic
1045881535 8:107046003-107046025 AGCCAGGAGGGGAGATTGGTAGG + Intergenic
1047239525 8:123073217-123073239 CTCCAGGAGGAGATGCGGGGTGG + Intronic
1047260362 8:123253029-123253051 CTCTATGAAGGGAGACTGGCAGG - Intronic
1048179997 8:132185636-132185658 CCCCAGGAGGGGAGATTTAGAGG + Intronic
1049046791 8:140158729-140158751 CCACAGCAGGGGAGTCTGGGTGG - Intronic
1049390755 8:142369122-142369144 CTGCAGGAGGGGAAACAGTGTGG + Intronic
1049453462 8:142675199-142675221 CTCCAGGAAGGGGGAGTGGCAGG + Intronic
1049504981 8:142991348-142991370 CTCCAGTTGGGGAGACTTGCTGG + Intergenic
1049577693 8:143397282-143397304 GTCCAGGAGGGGACAGTGGGAGG - Intergenic
1051349418 9:16184984-16185006 CTCCAGGAGGGGAGCCTCCATGG + Intergenic
1053803925 9:41783005-41783027 CACCAGGTGGGAGGACTGGGTGG + Intergenic
1054141356 9:61532452-61532474 CACCAGGTGGGAGGACTGGGTGG - Intergenic
1054192229 9:61994503-61994525 CACCAGGTGGGAGGACTGGGTGG + Intergenic
1054646177 9:67594188-67594210 CACCAGGTGGGAGGACTGGGTGG - Intergenic
1056660737 9:88541151-88541173 CTCCTTGAGGGGACACTGGTGGG - Intronic
1057561399 9:96130702-96130724 TTCCAGGAGGGCAGACTAGAGGG + Intergenic
1057741018 9:97711202-97711224 CAGCAGGTGGGGGGACTGGGTGG + Intergenic
1058690688 9:107518021-107518043 CTCCAGGAGAGGAGCCAGTGTGG - Intergenic
1059347272 9:113637574-113637596 TTCCAGGAAGGGAGACAGGCAGG - Intergenic
1059348585 9:113648945-113648967 CTGCTGGAGGGGAGGCTGAGGGG - Intergenic
1059364860 9:113778930-113778952 CTCCTGGAGCGGAGGCTGGCTGG + Intergenic
1059424672 9:114213304-114213326 CGCCAGGAGGGGAGATGAGGAGG - Intronic
1060188775 9:121579342-121579364 ACCCAGGAGAGGAGACTGTGGGG - Intronic
1060207907 9:121693385-121693407 CTCCAGGAGGGGAGAGATGCTGG - Intronic
1061257232 9:129460069-129460091 CTCCACGAGGGAGGACTCGGGGG + Intergenic
1061486403 9:130922661-130922683 CTTCAGGAGAGGTGACTTGGCGG - Intronic
1061697429 9:132387438-132387460 CTCTAGCAGGGAAGACTGGGCGG + Intronic
1061773313 9:132944455-132944477 CTCCAGCCGGGGAGGCTCGGAGG - Intronic
1061803922 9:133127814-133127836 CTCCAGGAGACCACACTGGGTGG + Intronic
1061875619 9:133542166-133542188 CTCCAGGAGGTGCCAGTGGGAGG + Intronic
1062212553 9:135372719-135372741 CCCCAGGAGGGGCTGCTGGGAGG + Intergenic
1062394761 9:136348298-136348320 CCTCAGGAGGGGGGATTGGGTGG + Intronic
1062568305 9:137172968-137172990 CCAGAGGAGGGGAGGCTGGGAGG - Intergenic
1062637528 9:137499518-137499540 CACCAGCAGGGGACCCTGGGTGG - Intronic
1185775004 X:2794801-2794823 CTCCAGGCTGGGGGACTGGATGG + Intronic
1188080326 X:25830938-25830960 CTCAGGGAAGGGAGACTGGGAGG - Intergenic
1188525574 X:31084335-31084357 CTACTGGAGGGGAGGGTGGGAGG + Intergenic
1190434036 X:50405949-50405971 TTGGAGGAGAGGAGACTGGGAGG - Intronic
1190730831 X:53224632-53224654 CTCGAGGTGGGGAGAGGGGGTGG - Intronic
1190957342 X:55208495-55208517 CTAGAGCAGGGGAGACGGGGAGG - Intronic
1193162899 X:78247727-78247749 TTCCAGAAGGGGAAAATGGGTGG + Intergenic
1195956075 X:110332055-110332077 CTCAAGGAAGGGAGACTAGGTGG - Intronic
1199767901 X:150953967-150953989 CTCCAAGAGAGGAGACTGGCTGG - Intergenic
1199941627 X:152633314-152633336 TTCCAAGAGAGGAGAGTGGGAGG - Intergenic
1200114159 X:153762843-153762865 CTCCAGGAGGGGAGGCTTGGGGG - Intergenic