ID: 1099365921

View in Genome Browser
Species Human (GRCh38)
Location 12:81765357-81765379
Sequence AGTTATCTGCAGAATATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099365921_1099365926 16 Left 1099365921 12:81765357-81765379 CCTGCCATATTCTGCAGATAACT No data
Right 1099365926 12:81765396-81765418 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1099365921_1099365927 22 Left 1099365921 12:81765357-81765379 CCTGCCATATTCTGCAGATAACT No data
Right 1099365927 12:81765402-81765424 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1099365921_1099365925 15 Left 1099365921 12:81765357-81765379 CCTGCCATATTCTGCAGATAACT No data
Right 1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1099365921_1099365928 25 Left 1099365921 12:81765357-81765379 CCTGCCATATTCTGCAGATAACT No data
Right 1099365928 12:81765405-81765427 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1099365921_1099365923 4 Left 1099365921 12:81765357-81765379 CCTGCCATATTCTGCAGATAACT No data
Right 1099365923 12:81765384-81765406 TCCTTTCGAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099365921 Original CRISPR AGTTATCTGCAGAATATGGC AGG (reversed) Intergenic
No off target data available for this crispr