ID: 1099368651

View in Genome Browser
Species Human (GRCh38)
Location 12:81801748-81801770
Sequence ATACGCGGTATGGCGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099368651_1099368656 14 Left 1099368651 12:81801748-81801770 CCAGTCTCCGCCATACCGCGTAT No data
Right 1099368656 12:81801785-81801807 AGTTCACCATTTATCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099368651 Original CRISPR ATACGCGGTATGGCGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr