ID: 1099370546

View in Genome Browser
Species Human (GRCh38)
Location 12:81824723-81824745
Sequence TTAAGTCCTGTTGGTCCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099370546_1099370548 -7 Left 1099370546 12:81824723-81824745 CCGAGGGGACCAACAGGACTTAA No data
Right 1099370548 12:81824739-81824761 GACTTAACTAATGCAAAATATGG No data
1099370546_1099370549 23 Left 1099370546 12:81824723-81824745 CCGAGGGGACCAACAGGACTTAA No data
Right 1099370549 12:81824769-81824791 TTTAGCTACTTAAAAGACCTAGG No data
1099370546_1099370550 27 Left 1099370546 12:81824723-81824745 CCGAGGGGACCAACAGGACTTAA No data
Right 1099370550 12:81824773-81824795 GCTACTTAAAAGACCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099370546 Original CRISPR TTAAGTCCTGTTGGTCCCCT CGG (reversed) Intergenic
No off target data available for this crispr