ID: 1099370547

View in Genome Browser
Species Human (GRCh38)
Location 12:81824732-81824754
Sequence TTGCATTAGTTAAGTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099370547_1099370549 14 Left 1099370547 12:81824732-81824754 CCAACAGGACTTAACTAATGCAA No data
Right 1099370549 12:81824769-81824791 TTTAGCTACTTAAAAGACCTAGG No data
1099370547_1099370550 18 Left 1099370547 12:81824732-81824754 CCAACAGGACTTAACTAATGCAA No data
Right 1099370550 12:81824773-81824795 GCTACTTAAAAGACCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099370547 Original CRISPR TTGCATTAGTTAAGTCCTGT TGG (reversed) Intergenic
No off target data available for this crispr