ID: 1099370550

View in Genome Browser
Species Human (GRCh38)
Location 12:81824773-81824795
Sequence GCTACTTAAAAGACCTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099370547_1099370550 18 Left 1099370547 12:81824732-81824754 CCAACAGGACTTAACTAATGCAA No data
Right 1099370550 12:81824773-81824795 GCTACTTAAAAGACCTAGGTTGG No data
1099370546_1099370550 27 Left 1099370546 12:81824723-81824745 CCGAGGGGACCAACAGGACTTAA No data
Right 1099370550 12:81824773-81824795 GCTACTTAAAAGACCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099370550 Original CRISPR GCTACTTAAAAGACCTAGGT TGG Intergenic
No off target data available for this crispr