ID: 1099370564

View in Genome Browser
Species Human (GRCh38)
Location 12:81824856-81824878
Sequence TGGACAGGGTTCATTAGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099370557_1099370564 -3 Left 1099370557 12:81824836-81824858 CCCACTGCCAGTAACTTTTCTGG No data
Right 1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG No data
1099370555_1099370564 11 Left 1099370555 12:81824822-81824844 CCGTATTCTCCTTACCCACTGCC No data
Right 1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG No data
1099370559_1099370564 -4 Left 1099370559 12:81824837-81824859 CCACTGCCAGTAACTTTTCTGGA No data
Right 1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG No data
1099370562_1099370564 -10 Left 1099370562 12:81824843-81824865 CCAGTAACTTTTCTGGACAGGGT No data
Right 1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG No data
1099370553_1099370564 29 Left 1099370553 12:81824804-81824826 CCTTATCCATAATACAATCCGTA No data
Right 1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG No data
1099370554_1099370564 23 Left 1099370554 12:81824810-81824832 CCATAATACAATCCGTATTCTCC No data
Right 1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG No data
1099370556_1099370564 2 Left 1099370556 12:81824831-81824853 CCTTACCCACTGCCAGTAACTTT No data
Right 1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099370564 Original CRISPR TGGACAGGGTTCATTAGTAT GGG Intergenic
No off target data available for this crispr