ID: 1099375646

View in Genome Browser
Species Human (GRCh38)
Location 12:81893930-81893952
Sequence AGTAATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099375646_1099375648 4 Left 1099375646 12:81893930-81893952 CCTGCCATCTTCTGCAGATTACT No data
Right 1099375648 12:81893957-81893979 TATTTTTAAGAGACAGCTCTTGG No data
1099375646_1099375650 22 Left 1099375646 12:81893930-81893952 CCTGCCATCTTCTGCAGATTACT No data
Right 1099375650 12:81893975-81893997 CTTGGCCTGTTACTAGGCTTTGG No data
1099375646_1099375649 16 Left 1099375646 12:81893930-81893952 CCTGCCATCTTCTGCAGATTACT No data
Right 1099375649 12:81893969-81893991 ACAGCTCTTGGCCTGTTACTAGG 0: 174
1: 194
2: 145
3: 123
4: 215
1099375646_1099375651 25 Left 1099375646 12:81893930-81893952 CCTGCCATCTTCTGCAGATTACT No data
Right 1099375651 12:81893978-81894000 GGCCTGTTACTAGGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099375646 Original CRISPR AGTAATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr