ID: 1099384890

View in Genome Browser
Species Human (GRCh38)
Location 12:82002427-82002449
Sequence GATTTAAGAATATCAACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099384888_1099384890 -1 Left 1099384888 12:82002405-82002427 CCTGATGCTTGTGAGAAACAAGG No data
Right 1099384890 12:82002427-82002449 GATTTAAGAATATCAACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099384890 Original CRISPR GATTTAAGAATATCAACATC AGG Intergenic
No off target data available for this crispr