ID: 1099385233

View in Genome Browser
Species Human (GRCh38)
Location 12:82005954-82005976
Sequence CAGTCTCTTTACCCATTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099385233_1099385234 1 Left 1099385233 12:82005954-82005976 CCATTAAATGGGTAAAGAGACTG No data
Right 1099385234 12:82005978-82006000 CTCACTCGCCACTCAACAGTTGG No data
1099385233_1099385235 6 Left 1099385233 12:82005954-82005976 CCATTAAATGGGTAAAGAGACTG No data
Right 1099385235 12:82005983-82006005 TCGCCACTCAACAGTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099385233 Original CRISPR CAGTCTCTTTACCCATTTAA TGG (reversed) Intergenic
No off target data available for this crispr