ID: 1099398584

View in Genome Browser
Species Human (GRCh38)
Location 12:82172860-82172882
Sequence CTCTCTGAGCAGCAGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099398581_1099398584 17 Left 1099398581 12:82172820-82172842 CCAAGGAAAATTAAAACGTGGGA No data
Right 1099398584 12:82172860-82172882 CTCTCTGAGCAGCAGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099398584 Original CRISPR CTCTCTGAGCAGCAGGACCA AGG Intergenic
No off target data available for this crispr