ID: 1099400260

View in Genome Browser
Species Human (GRCh38)
Location 12:82194837-82194859
Sequence TGGGTCTCCTTGGGAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099400260_1099400272 8 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400272 12:82194868-82194890 TACTGGGGTAACTGTGCACTGGG No data
1099400260_1099400271 7 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400271 12:82194867-82194889 TTACTGGGGTAACTGTGCACTGG No data
1099400260_1099400273 9 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400273 12:82194869-82194891 ACTGGGGTAACTGTGCACTGGGG No data
1099400260_1099400265 -9 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400265 12:82194851-82194873 GGAGACCCATGGCCTTTTACTGG No data
1099400260_1099400267 -7 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400267 12:82194853-82194875 AGACCCATGGCCTTTTACTGGGG No data
1099400260_1099400276 16 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400276 12:82194876-82194898 TAACTGTGCACTGGGGAAAGGGG No data
1099400260_1099400266 -8 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400266 12:82194852-82194874 GAGACCCATGGCCTTTTACTGGG No data
1099400260_1099400274 14 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400274 12:82194874-82194896 GGTAACTGTGCACTGGGGAAAGG 0: 70
1: 122
2: 130
3: 117
4: 336
1099400260_1099400275 15 Left 1099400260 12:82194837-82194859 CCATCCTTTCCCAAGGAGACCCA No data
Right 1099400275 12:82194875-82194897 GTAACTGTGCACTGGGGAAAGGG 0: 77
1: 122
2: 141
3: 146
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099400260 Original CRISPR TGGGTCTCCTTGGGAAAGGA TGG (reversed) Intergenic
No off target data available for this crispr