ID: 1099403216

View in Genome Browser
Species Human (GRCh38)
Location 12:82225799-82225821
Sequence AAGGAGAAGTAGGTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 0, 2: 2, 3: 73, 4: 849}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099403216_1099403220 2 Left 1099403216 12:82225799-82225821 CCATCCTCAACCTACTTCTCCTT 0: 1
1: 0
2: 2
3: 73
4: 849
Right 1099403220 12:82225824-82225846 TCACCTCCCACTAGAGCAACAGG 0: 1
1: 0
2: 1
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099403216 Original CRISPR AAGGAGAAGTAGGTTGAGGA TGG (reversed) Intronic
900459308 1:2793945-2793967 AAGAAGAAGGAGGGCGAGGAGGG - Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901469189 1:9443871-9443893 GAGGAGAAGGAGGGAGAGGAAGG - Intergenic
901798712 1:11694785-11694807 AAGAAGAAGAAGGTTGTGGGAGG + Intronic
902550825 1:17218710-17218732 AAGGAGAATGAGTTTGGGGATGG + Intronic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
902606811 1:17573591-17573613 CAGGAGGAGGAGGTAGAGGAGGG + Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903187450 1:21636849-21636871 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904634130 1:31866646-31866668 AAGGTGAAGTAGGAACAGGAAGG - Intergenic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905203703 1:36330671-36330693 ATGGAGGAGATGGTTGAGGAAGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905535973 1:38722135-38722157 AAAGAGAAGAAGGGAGAGGAAGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907848052 1:58227695-58227717 AGGGAGAAGTAGGTCATGGAGGG + Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909135314 1:71791795-71791817 AATTGGAAGTAGGTAGAGGAAGG + Intronic
909320083 1:74274287-74274309 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
909415252 1:75399088-75399110 TAGGAGATGGAGGTGGAGGAGGG + Intronic
909521709 1:76576040-76576062 AAGGAACAGAAGGTTGGGGAGGG + Intronic
909559164 1:76990622-76990644 CAGGAAGATTAGGTTGAGGATGG - Intronic
909561784 1:77016015-77016037 GAGGAGGAGGAGGTGGAGGAGGG - Intronic
910174222 1:84411670-84411692 AAGGAGAAGTAGGGACAGGTTGG + Intronic
910243904 1:85118789-85118811 AGGAAGAAGGAGGTTGGGGAAGG + Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911553426 1:99312731-99312753 AAGCAGAAGTAGGAGTAGGAGGG + Intergenic
911563489 1:99434557-99434579 AAGGAAAAGTTTCTTGAGGAAGG - Intergenic
911725955 1:101240609-101240631 AAGTAAAAGAACGTTGAGGAGGG - Exonic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912141257 1:106731087-106731109 GAGGAGGAGTTGGTGGAGGAAGG + Intergenic
912151592 1:106865265-106865287 AAGAAGAAGTAGGTTAAGACAGG - Intergenic
912194228 1:107378634-107378656 CAGGAGAAGAATGTCGAGGAAGG + Intronic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
913012376 1:114697095-114697117 AAGGAGAAGCAGGTTCATGGAGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914319690 1:146547005-146547027 AAGGAGAAGTGGGGTTTGGAAGG + Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915393170 1:155562512-155562534 AAGGAGTGGAAGGTTGAGGGGGG - Exonic
915975213 1:160381546-160381568 AAGGAGAATAAGGTTAGGGATGG - Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916701239 1:167297821-167297843 AATGAGAATTGGGCTGAGGATGG + Intronic
917123459 1:171664823-171664845 GAGGAGAAGTAGGTTTGGAAAGG - Intergenic
917683723 1:177394681-177394703 AAGGTGAAGAAAGTTGAGAAGGG + Intergenic
917830642 1:178881331-178881353 AAGGAAAAGTATGCTGGGGATGG + Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918810747 1:189116643-189116665 AATGTGAAGTAGGCTGAGCATGG + Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919625026 1:199903229-199903251 AAGGAGAATTACCTTGAGGGAGG + Intergenic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921458167 1:215396582-215396604 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
922563911 1:226588933-226588955 CCGGAGGAGTTGGTTGAGGAAGG - Intronic
922800631 1:228363166-228363188 AAGGAGGAGGAGGTGGAGGAGGG + Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923135998 1:231119759-231119781 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923211927 1:231811263-231811285 AGGGAGAAGGGGGTTGGGGAGGG + Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923431714 1:233928522-233928544 AAGGAAAAGTAGGTTCAGAGAGG - Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924362710 1:243257743-243257765 AAACATCAGTAGGTTGAGGAAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063413216 10:5852716-5852738 AAGTAGAAGTAGGCTGGGCACGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063654368 10:7972994-7973016 AAGGAGCAGTAGGGTGAACAGGG + Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1065290860 10:24227944-24227966 AAGGAGGGGATGGTTGAGGAGGG - Intronic
1065427254 10:25618648-25618670 AAGGAGGGGTAGTTTGAGGAAGG + Intergenic
1065614221 10:27504054-27504076 AAGGAGGGTTAGGTTGAGGCTGG + Intergenic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1066591737 10:37002231-37002253 AAGAAGAAGAAAGTTGTGGAAGG + Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068232744 10:54191961-54191983 AAGGAGAAGGAGGGGAAGGAAGG + Intronic
1068435735 10:56989022-56989044 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1068564192 10:58553205-58553227 AAGGGGAATTAGGTTGCAGATGG + Intronic
1068594947 10:58892746-58892768 AAGCAGAAGCACCTTGAGGAAGG - Intergenic
1068697223 10:59980544-59980566 GAGGAAAAGGAGGTTGTGGAGGG + Intergenic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1069824118 10:71244890-71244912 ACTGAGAAGTGGGTTGGGGAGGG - Intronic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1071311680 10:84348634-84348656 ATGATGGAGTAGGTTGAGGAGGG + Intronic
1071513219 10:86280356-86280378 AAGGAGCAGCAAGTAGAGGAGGG - Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072478490 10:95786423-95786445 AAGGAGACGCAGGTTCAGTAGGG + Intronic
1072712224 10:97723272-97723294 AAAGGGAAGTAGCTTTAGGAAGG + Intergenic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073056759 10:100708047-100708069 AAGGAGAAGGAAGGGGAGGACGG + Intergenic
1073689160 10:105788127-105788149 AAGGAGAAGGAGATAGAAGAAGG - Intergenic
1074571625 10:114629688-114629710 AAGGGTAAGTAGGTTGCTGAAGG - Intronic
1074602447 10:114929116-114929138 AAGAAAATGTAGGTTGAGCATGG + Intergenic
1075300675 10:121321214-121321236 GAGGAGAAGAAGGTAGTGGAGGG + Intergenic
1076372582 10:129964762-129964784 AAGGAGAAGTGGGAAGAGGCAGG + Intergenic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077523294 11:3049052-3049074 GAGGAGAAGGAGGGTGAGCAGGG - Intronic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078459227 11:11500713-11500735 AAAGAGAAGTAAGGAGAGGAGGG - Intronic
1079141355 11:17812129-17812151 ATGGAGAAGTGGGTTGGGGCTGG - Intronic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079767096 11:24407287-24407309 AAGTAGTAGTAGGTTGGTGAGGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080542231 11:33278940-33278962 AAATAGAAGTAAGTTGAGTAAGG + Intronic
1080912625 11:36618872-36618894 AAGGAGAAGTACGTTGCTGGAGG + Intronic
1081209096 11:40309872-40309894 AAGGAAAGGATGGTTGAGGAGGG + Intronic
1081696796 11:45117455-45117477 GAGGAGAAGCAGGTTGAGTGTGG + Intronic
1081699558 11:45144577-45144599 AAAGAGAAGTAGATAAAGGAGGG - Intronic
1082192349 11:49261799-49261821 ATGGAGGAGTAGGTGGAGCACGG - Intergenic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082762088 11:57136891-57136913 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083373984 11:62205050-62205072 AGGGAGAGGTAGGTTAAAGATGG - Intergenic
1083545217 11:63544567-63544589 AAGGTGAAGTAGGGAGAGAAGGG - Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084643535 11:70440512-70440534 AAGGAGAATTAGGTAGCAGATGG + Intergenic
1084961312 11:72718209-72718231 AAGGAGAAGTGCTTTCAGGAAGG + Intronic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1086308110 11:85503935-85503957 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087694184 11:101356836-101356858 AAGGAGGAATAGGATGAGAAGGG - Intergenic
1088023690 11:105152540-105152562 AAGGAGAAGTGTGCTGAGAAAGG - Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1089546990 11:119235524-119235546 GAGGAGGAGTAGGAAGAGGAGGG + Intronic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090033154 11:123224860-123224882 AGGGAGAAGTGGGTAGAGAAAGG + Intergenic
1090502966 11:127279720-127279742 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090738841 11:129638027-129638049 GAGGAGATGGAGGTTGAAGAGGG - Intergenic
1090866295 11:130703815-130703837 AAAGACAGGGAGGTTGAGGAAGG - Intronic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091971219 12:4788533-4788555 GAGGAGGAATAGGTTGAAGAAGG + Intronic
1092084084 12:5741480-5741502 AAGGAGCGGTAGGAAGAGGAGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093398400 12:18711610-18711632 AAGGAGAAGTAGGTTACAGTTGG + Intronic
1093775328 12:23067138-23067160 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1093847652 12:23993579-23993601 ATGGAGGAGTATGTTGGGGATGG - Intergenic
1094043535 12:26142715-26142737 GAAGAGAAGTGGGTTGAGGATGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094199736 12:27783261-27783283 GAGGAAAAGGAGGTAGAGGAAGG + Intronic
1094234393 12:28146899-28146921 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1095540129 12:43299925-43299947 AAGGAGGAGGAGGTGGGGGAGGG + Intergenic
1095651776 12:44619647-44619669 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096155629 12:49339862-49339884 AATGGGAAGTAGGTAGAGAAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099980094 12:89589348-89589370 AAAGAGAAGAAGGTAGATGAAGG + Exonic
1100201240 12:92299896-92299918 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1100344540 12:93714917-93714939 GAGGAGAAGGAGGTTGGGAATGG + Intronic
1101502270 12:105315292-105315314 AAGTAGAACTTGTTTGAGGAAGG - Intronic
1101598682 12:106189631-106189653 AAGTAGAGGAAGGTTGGGGAAGG + Intergenic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102913663 12:116737526-116737548 AAGGAGGAGGAAGGTGAGGAAGG + Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103523738 12:121553292-121553314 GAGGAGAAGTGGGTGGAGGTGGG - Intronic
1103590578 12:121989563-121989585 AGGGAGTAGTGGGCTGAGGAGGG - Intronic
1103932383 12:124457588-124457610 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1104730088 12:131100377-131100399 ATGGTGAAGTTGGTTGATGATGG + Intronic
1105814626 13:24023538-24023560 AAGAAGAATTAGGTTGCAGATGG + Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106330355 13:28733811-28733833 AAGGAGAGGTGGGTGGAGGCAGG - Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106835554 13:33630792-33630814 AAGGTGAAGGAGGATTAGGATGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107288034 13:38818547-38818569 AAGGAGAGGTAGATGGAGAAAGG + Intronic
1107384102 13:39889481-39889503 AGTGAGCAGTGGGTTGAGGAAGG - Intergenic
1108050220 13:46427559-46427581 GAGGAGGAGGAGGTAGAGGAGGG - Intronic
1108711354 13:53035602-53035624 AAAGAGATGGAGGGTGAGGATGG - Intronic
1109542742 13:63800877-63800899 GAGGAGGAGGAGGTAGAGGAGGG - Intergenic
1109653795 13:65364063-65364085 AAGTCTAAGTGGGTTGAGGAGGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111057063 13:82964849-82964871 AGGCAGAAGGAGGTTGAGGGAGG + Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1111698844 13:91660807-91660829 AAGGAGGAGAAGGTTTAAGAAGG - Intronic
1111904424 13:94238769-94238791 AAGGAGAGATGGGTTGAGAAAGG + Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113412066 13:110099091-110099113 GAGGAGGAGGAGGTGGAGGATGG + Intergenic
1113556594 13:111240534-111240556 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113882625 13:113636121-113636143 AATGACAAGTAGGTTGTGGGCGG + Exonic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114207020 14:20581611-20581633 TAGGAGAAGGAAGCTGAGGATGG - Intergenic
1114373152 14:22112392-22112414 TAGGAGAAGTTGGATGAAGAGGG + Intergenic
1114787849 14:25621536-25621558 AATGAGAAGTATGTGGAGGGAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116111306 14:40588084-40588106 AAGGAAAAGTAGATTTAGGATGG + Intergenic
1116233925 14:42253634-42253656 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116654387 14:47632785-47632807 AAGGAGAGAGAGGTTGGGGAAGG - Intronic
1116658225 14:47675992-47676014 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117761636 14:59035328-59035350 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1118007261 14:61574567-61574589 AATGAGAAGTGGGTTGAAGGAGG - Intronic
1118388175 14:65274076-65274098 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1118815287 14:69308051-69308073 AAGGAGAGGAAAGTGGAGGAGGG - Intronic
1119042264 14:71285654-71285676 AAGGAGAAGGTGATTGAAGATGG - Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119867584 14:77986704-77986726 AAGTAGAACTAGTTTGAGTAGGG - Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120271120 14:82314398-82314420 AAGTAGAAGTAGATTGATAATGG + Intergenic
1120826161 14:88957512-88957534 AGGGAGAAGTAGTTTGGGGGTGG - Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121153669 14:91663074-91663096 GAGGAGAAGGAGGTGGAGGAGGG - Intronic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121510993 14:94513500-94513522 AAGATGAAGTAACTTGAGGAGGG - Intronic
1121735729 14:96216749-96216771 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1122070644 14:99203515-99203537 AAGGAGAAGTGGGTTCGGAATGG + Intronic
1122106340 14:99459634-99459656 AAAGATAAGTATGTAGAGGAAGG - Intronic
1122167136 14:99835556-99835578 AAGGAGAAGGAAGTAGGGGATGG - Intronic
1122288908 14:100668955-100668977 AAGGACAAGTAGGCTGAGGCTGG - Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1123392896 15:19895234-19895256 AAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1123969107 15:25488424-25488446 AGGAAGAAGTAAGCTGAGGAAGG + Intergenic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124701147 15:31913355-31913377 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1125727893 15:41877398-41877420 GAGGAGAAGGAGGCTGACGAGGG - Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1128304164 15:66587049-66587071 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304189 15:66587127-66587149 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128328758 15:66742225-66742247 CATGAGAAGTAGGCTGAGAAAGG - Intronic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1129787382 15:78318820-78318842 CAGGAGAAGGCAGTTGAGGAGGG + Intergenic
1130552076 15:84895636-84895658 CAGGAGAGGGAGGTTGTGGAGGG + Intronic
1130721103 15:86386264-86386286 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1131014180 15:89043625-89043647 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131901113 15:97088690-97088712 AAGGAGGAGGAGGAAGAGGAAGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133901395 16:9978554-9978576 AAGGAGGAGTAAGAGGAGGATGG - Intronic
1134881925 16:17752491-17752513 GAGGAGATGTGGGTGGAGGAAGG + Intergenic
1134997410 16:18750660-18750682 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135795268 16:25435302-25435324 AAGGAAAAGTTGGTTTAGGCAGG - Intergenic
1135823649 16:25706737-25706759 AAGGGGAATTAGGTTGCAGATGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1137386460 16:48047351-48047373 GAGGAGAAGGAGGTGGAGGATGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137617495 16:49856221-49856243 AAGGAGGAGGAGGGTGAGGGTGG - Intronic
1138130597 16:54476343-54476365 CAGGAGAAGGAGGTAGAGGGTGG + Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138395351 16:56700030-56700052 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138702825 16:58882317-58882339 AAGGAGAAGAGGGTGGAGAAGGG + Intergenic
1139490437 16:67283163-67283185 AGGCAGAAGAGGGTTGAGGATGG + Intronic
1140013837 16:71163070-71163092 AAGGAGAACTAGGGTTTGGAAGG - Intronic
1140642365 16:76991081-76991103 AAGGAGAATTAGGTTGCAAATGG - Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1140965986 16:79966515-79966537 AAGGAAAGGAAGGTTGAGGAAGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141635674 16:85312745-85312767 GAGGAGAAGGAGGGGGAGGAAGG + Intergenic
1141840622 16:86571966-86571988 AGGTGGAAGGAGGTTGAGGATGG + Intergenic
1141893520 16:86943966-86943988 AAGAAAATGTAGGTTGAGGCTGG - Intergenic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143551035 17:7630672-7630694 AAGGAGGAGGAGGTTCTGGAAGG - Exonic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143813880 17:9495316-9495338 TAGGAGCACTTGGTTGAGGATGG - Intronic
1143832346 17:9662400-9662422 AAGGAGACGTGGGTTTGGGATGG - Intronic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144247807 17:13384709-13384731 AAGGAGAGGAAGCTTGAGCATGG + Intergenic
1144419869 17:15086719-15086741 AAGGAGGAGGGGGTTGAGGGAGG + Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1146475904 17:33162600-33162622 GAGGAGAAGTGGCTGGAGGAGGG - Intronic
1146531309 17:33609853-33609875 AAGGAGAGAGGGGTTGAGGAAGG + Intronic
1146531313 17:33609872-33609894 AAGGAAAAAGAGGTAGAGGAGGG + Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147642392 17:42011577-42011599 GAGGAGAAATAAGTTAAGGAAGG - Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148493509 17:48037926-48037948 AAGGAGAGGTGGGGTGAGGGCGG - Intronic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1149033738 17:52111774-52111796 AAGGAGATGTAGGTAGAGCCAGG - Intronic
1149249671 17:54753971-54753993 CAGGAGAAATAGGTCCAGGAGGG + Intergenic
1149277156 17:55054604-55054626 AAGGTGAAGTAGTTTGACAAAGG - Intronic
1150373556 17:64662065-64662087 AAGGAGAAGTGGGAGGAGGGGGG - Exonic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1151351383 17:73534080-73534102 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1152036600 17:77877144-77877166 AGGGAGGAGGAGGTTGAGGGAGG + Intergenic
1152124550 17:78438425-78438447 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1152277624 17:79367345-79367367 GAGGAGGAGTAGGAGGAGGAGGG - Intronic
1152315955 17:79580279-79580301 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152774467 17:82191956-82191978 AAGTAGAATTAGGTTGGGCATGG - Intronic
1152842110 17:82576432-82576454 CAGGAGAAATAGGTCTAGGAGGG + Intronic
1153141950 18:1982883-1982905 AAGAAGAAGTATGTAAAGGAAGG - Intergenic
1153453324 18:5253809-5253831 AAGGAGAGGTAGCTTGAGGTGGG + Intergenic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155355089 18:24944180-24944202 AATGAGAAGGGGGTTGAGGGAGG + Intergenic
1156315449 18:35965087-35965109 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156480401 18:37432796-37432818 AAAGAGGAGAATGTTGAGGAGGG - Intronic
1157100343 18:44723663-44723685 AAGGCGTGGTAGGTTCAGGAAGG - Intronic
1157215644 18:45781034-45781056 AAGGGAAAGGAGGTAGAGGATGG - Intergenic
1157378244 18:47186040-47186062 CAGGAGAAGTAGGTTTCAGAAGG - Intergenic
1157431153 18:47627582-47627604 AGGGAGAAGTCGGATCAGGAGGG - Intergenic
1157581295 18:48775700-48775722 TAAGTGGAGTAGGTTGAGGAAGG + Intronic
1157711359 18:49851987-49852009 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1157763835 18:50283173-50283195 AAGGAAAAGTGAGGTGAGGAAGG + Intronic
1158227333 18:55214854-55214876 AAGGAGAAATGGGAGGAGGAGGG - Intergenic
1158349324 18:56549125-56549147 TAGGAGAAGCGGGTGGAGGATGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159300992 18:66567341-66567363 AAGGAGTAGAAGGTGGAGAAGGG + Intronic
1159593582 18:70361030-70361052 AAGGTGAAGCAGGTACAGGAAGG + Intergenic
1159915400 18:74183191-74183213 GAGGAGAAGTAGGGGGAGGTGGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160254226 18:77233865-77233887 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160973930 19:1783251-1783273 CAGGAGGAGAAGGTGGAGGAGGG - Exonic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1164577077 19:29411792-29411814 ATGAAGAAGTAGGTTAAGTAAGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1165441948 19:35833525-35833547 AAGAAGATGGAGGTGGAGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1167064636 19:47175322-47175344 AAGGAGACCAAGGTTGAGCATGG + Intronic
1167166531 19:47803154-47803176 AGGGAAAAGTAGGGGGAGGAGGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
925047804 2:787883-787905 GAAGAGAAGCAGGTTGAGGCAGG + Intergenic
925792362 2:7504511-7504533 GAGGAGGAGGAGGTAGAGGAGGG + Intergenic
925792372 2:7504558-7504580 GAGGAGGAGGAGGTAGAGGAGGG + Intergenic
926147952 2:10408219-10408241 AAGGAGAGATTGGTAGAGGAAGG + Intronic
926349010 2:11978334-11978356 AAGCAGAAGTAGGTTTCAGATGG - Intergenic
926561561 2:14423384-14423406 AAGGAGAGTTAGTTTCAGGAAGG - Intergenic
926843695 2:17110053-17110075 AAGGTTAACTAGGCTGAGGATGG + Intergenic
927024361 2:19050224-19050246 AAGGAGAGTTATGTTCAGGAGGG - Intergenic
927367869 2:22319616-22319638 AAGGAGGCATAGGTTCAGGATGG + Intergenic
927369747 2:22340746-22340768 AAGGAGAAGAAAGTTGGGTAAGG - Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929741859 2:44610985-44611007 AAAGAGAAGTAGATAGAGAAGGG + Intronic
930297134 2:49569093-49569115 AAAGAGAACTATGTTGTGGAGGG - Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
931295753 2:60923534-60923556 AAGGAGAAGCAAGTTTGGGAGGG - Exonic
932160442 2:69454991-69455013 GGGGAGAAGTAGTTTGATGAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932985000 2:76715295-76715317 AAGAAGAAGAAGGGTAAGGAAGG + Intergenic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933299231 2:80523891-80523913 TAGGGGAAATTGGTTGAGGAAGG + Intronic
933564589 2:83934665-83934687 AAGGAGAAATGCGTTGATGAGGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
935022337 2:99243802-99243824 GAGGAAATGGAGGTTGAGGATGG + Intronic
935253666 2:101288587-101288609 TAAGGGAAATAGGTTGAGGAGGG - Intronic
936109190 2:109651080-109651102 AAGGAGAAGTTGGTGTATGAAGG - Intergenic
936379399 2:111970725-111970747 AGGGAGGAGTAGGGGGAGGAAGG - Intronic
936958221 2:118044739-118044761 AAGGAAAGGTGGGTTGTGGAAGG + Intergenic
937209849 2:120261373-120261395 AAGGAGAAGAAGGGCGTGGAAGG + Intronic
937402906 2:121600765-121600787 TAGGAAAAGGAGGTTGGGGATGG - Intronic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937453908 2:122025122-122025144 AAGGAGAAGAAGGTGGAAGATGG + Intergenic
937643938 2:124244624-124244646 AGGGAGAAGTGATTTGAGGAGGG + Intronic
937958525 2:127437640-127437662 AAGGAAAAGAAGGTGCAGGAGGG - Intronic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938736611 2:134191731-134191753 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
939054835 2:137352160-137352182 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940060327 2:149558830-149558852 GAGGAGGAGGAGGTAGAGGAGGG - Intergenic
940163151 2:150736273-150736295 AAGGAGAAGTAATTTGAGAGTGG + Intergenic
940692925 2:156941834-156941856 GATGAGAAGGAGTTTGAGGAGGG + Intergenic
941548937 2:166889850-166889872 AAGGAGAAGAAGGTGGAGATGGG - Intronic
941576506 2:167239347-167239369 AAGGAGAATTAAGTTGCAGATGG + Intronic
942250568 2:174044167-174044189 CAGGAGAAGGAGGTTGTGGTGGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942862259 2:180629085-180629107 GAAGAGAATGAGGTTGAGGATGG - Intergenic
942964883 2:181880044-181880066 AAGGAGAATAAGGTAGAAGAAGG - Intergenic
942983158 2:182106441-182106463 AAGGGGAATTTGGTTGAGGGTGG + Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
944403240 2:199352687-199352709 CAGAAGAACTAGGTGGAGGAGGG + Intronic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
945230973 2:207589481-207589503 AAGGGGAATTAGGTTGCAGATGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945283019 2:208054818-208054840 GAGGAGAAGGAGGTAGAGGAGGG + Intergenic
945360487 2:208890554-208890576 AAGGAGAGGTCGGTGGTGGAAGG - Intergenic
945447568 2:209956032-209956054 GAGGAGAAATAGGCTGAGTATGG - Intronic
945639758 2:212409239-212409261 ATGGACAAGTAGGTAGAGAAGGG - Intronic
945756387 2:213852471-213852493 AAGGAGGACTGTGTTGAGGATGG - Intronic
946130374 2:217601855-217601877 AAGGCTGAGCAGGTTGAGGAGGG + Intronic
946130407 2:217602135-217602157 AAGGCTGAGCAGGTTGAGGAGGG - Intronic
946302198 2:218830769-218830791 AGGCAGAAGTCGGTGGAGGAAGG - Exonic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946402515 2:219475978-219476000 GAGGAGAAGTAGGATGAGTCAGG - Intronic
946641622 2:221789829-221789851 AAGGAGAAATAGTTTTAGGATGG - Intergenic
946969030 2:225071112-225071134 AAGGAAAAGTAGGTGTGGGAAGG + Intergenic
947235004 2:227932049-227932071 AAGGAGAAGAAGGTGGGGGCGGG - Intergenic
947652825 2:231801756-231801778 AAAGAAAAGTAGGTTGGGCATGG - Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948681255 2:239636217-239636239 AAGGCACAGGAGGTTGAGGAGGG - Intergenic
1168731134 20:82027-82049 AAGGAGAAATAGGCTGGGCATGG + Intergenic
1168801433 20:645854-645876 AAGGAAAAGTTGTTTCAGGAGGG + Intergenic
1169499666 20:6147431-6147453 AAGGAGAAGTAACTTGATTAGGG - Intergenic
1170799963 20:19582890-19582912 AAGGTGAAGTCGGATGGGGAGGG + Intronic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1172107869 20:32527529-32527551 AAGGAAAAGCAGGTTGAAGGGGG - Intronic
1172323380 20:34015404-34015426 AAAAAGAAGTAGGTAGAGAAAGG - Intronic
1172474900 20:35229204-35229226 AAGGAGGAAGAGGTGGAGGAAGG - Intronic
1172563375 20:35908753-35908775 AATTAGAATTAGGTTGAGTAAGG - Intronic
1173153632 20:40588990-40589012 AAGGGGAATTAGGTTGCCGATGG - Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173344285 20:42184499-42184521 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1174639341 20:52029783-52029805 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174898565 20:54475573-54475595 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1175429383 20:58891271-58891293 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1175657760 20:60786880-60786902 GAGGAGGAGGAGGTTGAGGAGGG - Intergenic
1176345460 21:5740875-5740897 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176352274 21:5861459-5861481 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176499367 21:7583580-7583602 AAGTAGTAGAAGGTTGAGGGCGG + Intergenic
1176539781 21:8138945-8138967 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176558732 21:8321990-8322012 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176936290 21:14871473-14871495 AAAGAGAAGTAGGTCAAGGGTGG - Intergenic
1177175777 21:17699491-17699513 AAGCATGAGTGGGTTGAGGATGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178255356 21:31047438-31047460 AAGGAAGAATAGGGTGAGGAGGG - Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179142861 21:38742003-38742025 TATGAGAAGTAGCTTGAGGGTGG - Intergenic
1179480936 21:41678256-41678278 GGGGAGAAGAAGGTTGGGGAGGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181773688 22:25144804-25144826 CAGGAGAAGGAGGTTCAGGGTGG - Intronic
1181786327 22:25229876-25229898 AGGGAGGATTAGGTTGAGGCAGG + Intronic
1181818498 22:25457699-25457721 AGGGAGGATTAGGTTGAGGCAGG + Intergenic
1181850072 22:25743583-25743605 AAGGCCAAGTGGGTGGAGGAGGG + Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182003613 22:26941027-26941049 AAGGAGAAGCAGGTTGAAAGAGG + Intergenic
1182013892 22:27023008-27023030 AAGGAGAAGAAGGTGGAGCTGGG + Intergenic
1182745215 22:32600527-32600549 AAGGATGAGTAGGTTGTGGGTGG + Intronic
1182755876 22:32678530-32678552 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183029861 22:35095479-35095501 ATGGAGAAGGAGGTTGGGAATGG + Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184433988 22:44458916-44458938 AAGGATATGTAGGATGAAGATGG - Intergenic
1184984347 22:48119303-48119325 AATGAGGAGGAGGTTGAGAATGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203244734 22_KI270733v1_random:55300-55322 AAGTAGTAGAAGGTTGAGGGTGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
952135972 3:30420092-30420114 AGAGAGAAGTAGGGTGATGATGG + Intergenic
952207778 3:31197799-31197821 GAGGAGAATTGGGTTGTGGAGGG - Intergenic
953116074 3:39993701-39993723 ACAGAGAAGTAGGTTCAGTAGGG - Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953457197 3:43052756-43052778 TAGGACAAAGAGGTTGAGGATGG - Intronic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
953906467 3:46870773-46870795 AAGGTGGAGTAGGTGGAGTAGGG - Intronic
954370180 3:50166103-50166125 AAGGGGGAGTAGGGGGAGGAAGG - Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954862417 3:53702019-53702041 AGGGAGAACTGGGTTGTGGAGGG + Intronic
955855516 3:63268663-63268685 AAGGAGGAGGAGGAAGAGGAGGG + Intronic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956665412 3:71637534-71637556 AAGGAGAAAGAGGGGGAGGAGGG + Intergenic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957290397 3:78271019-78271041 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
958552815 3:95638232-95638254 AAATAGAAGTAGGTTTACGAGGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960674355 3:120180319-120180341 AAGGAGGAGTGGGATGAGGGAGG + Intronic
961670462 3:128524566-128524588 AGGGAGAAGTGGGCTGAGCACGG + Intergenic
962278591 3:134033607-134033629 GATGAGAAGTAGGTCCAGGATGG + Intronic
963857119 3:150266462-150266484 TGGGAAAAGTAGGTTGAGAACGG - Intergenic
963858943 3:150286742-150286764 AAGGGGGAGTAGGTTAAAGATGG + Intergenic
964090453 3:152870038-152870060 ATAGGGAAGTAGGTTGAGAAGGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964421861 3:156511696-156511718 AAGTAGAAAGAGCTTGAGGAAGG - Intronic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965451576 3:168845384-168845406 GAGGAGGAGTAGGAGGAGGATGG - Intergenic
965931524 3:174049403-174049425 AAGGAGAAAAGGGTTGAGCAGGG + Intronic
966169023 3:177056673-177056695 AAGGAAAAGTAGTTTTAGGGAGG - Intronic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
967319889 3:188184821-188184843 AAGGAGATGTAGGTTGGGCAGGG + Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968625190 4:1623840-1623862 GAGGAGAAAAAAGTTGAGGAGGG + Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
970099156 4:12501382-12501404 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
971021705 4:22543532-22543554 AAGAAGCAGTAGGCTGAGGCAGG + Intergenic
971025233 4:22582833-22582855 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
971070506 4:23086028-23086050 GAGGAGAGGAAGGTAGAGGAGGG + Intergenic
971251325 4:24975512-24975534 AAGGAAAAGTAGGATAGGGAAGG + Intronic
971262737 4:25071670-25071692 AAGGAGATGAAGTTGGAGGAAGG - Intergenic
971357985 4:25912259-25912281 GGGAAGAAGTAGGATGAGGATGG + Intronic
971370830 4:26017457-26017479 ATGGAGAAGTTGGTTGGGGTTGG - Intergenic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975189998 4:71449436-71449458 AAAGAAAATAAGGTTGAGGATGG + Intronic
975553376 4:75635962-75635984 GAGGAGAAGTGGATTGTGGAGGG - Intergenic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976695800 4:87918705-87918727 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977980721 4:103318264-103318286 AAGGAGAAGGAGGAGGAGCAGGG - Intergenic
978263929 4:106799436-106799458 AAAGAGAAATAGGGTGAGGGAGG - Intergenic
978584289 4:110261081-110261103 AATGAGACGTGGGATGAGGAAGG + Intergenic
978702307 4:111662589-111662611 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
979472539 4:121117655-121117677 AAGGAGCAGAAGGCTGAGGCAGG - Intergenic
980018917 4:127684624-127684646 AAGGAGGAGGAGGAAGAGGAAGG - Intronic
980071465 4:128246818-128246840 AAGAAAAAGTAGGGGGAGGAAGG + Intergenic
980080991 4:128343928-128343950 CAGGATGAGTAGGCTGAGGAGGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981459988 4:145002059-145002081 AAGGAGAAGTAGTGAGAGTAGGG - Intronic
981827878 4:148964717-148964739 AAAGAGAATTAGGTCGAAGATGG + Intergenic
982196939 4:152925876-152925898 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982263306 4:153515100-153515122 AGGGTGAAGTAGGCTGAGCACGG - Intronic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983599205 4:169505329-169505351 CAGGTGGAGTAGGCTGAGGAAGG - Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983832136 4:172340754-172340776 ATGGAGAATTAGGTGGAGTATGG - Intronic
984088486 4:175341305-175341327 AAAGAGAATTAGGTCAAGGAAGG + Intergenic
984797461 4:183676635-183676657 AAGGAGAAGCATGGTGAGAAAGG - Intronic
984870553 4:184321217-184321239 ATGATGAAGTAGGTTGAGAAGGG + Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985729290 5:1538317-1538339 AAGGAGAAGTAGGTGGCAAAGGG - Intergenic
986151722 5:5136277-5136299 AAAGTGAAGTAGTTTGAGGCTGG + Intergenic
986271272 5:6233004-6233026 AGGGAGAAATAGCTGGAGGAGGG + Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
986430843 5:7679559-7679581 GCAGAGCAGTAGGTTGAGGAAGG + Intronic
986879105 5:12147877-12147899 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
986927960 5:12781852-12781874 AAGGAGAAGTGGCCTGAGGTAGG - Intergenic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987906020 5:24078303-24078325 GAGGAGGAGTAGGGAGAGGAGGG + Intronic
987976587 5:25022480-25022502 AAGTAGAAATAGGGAGAGGAAGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989622548 5:43398935-43398957 AAAGAGCAGTAGGTTAGGGATGG - Intronic
989756199 5:44958680-44958702 AAGGAGGAGGAGGCAGAGGAGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990485144 5:56250828-56250850 AAGGAAAAGTTTCTTGAGGAGGG - Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
991189329 5:63851032-63851054 AAGAAGAAGTAGGAGGAGCAGGG + Intergenic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992949538 5:81844777-81844799 AAGGAAGAGGAGGTTGAGGAAGG + Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993164646 5:84336620-84336642 GAGGAGAAAGAGGTTGAAGAAGG + Intronic
993272653 5:85815004-85815026 AAGGGGAAGTATGGTGTGGAGGG - Intergenic
993959220 5:94276386-94276408 AAGGAGAAATTGGTGGAGTAGGG + Intronic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995548632 5:113257559-113257581 AGAGAGAAGTGGGTTGAGAAGGG + Intronic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996291948 5:121861663-121861685 AAGGAGAAAGAGGGTAAGGATGG + Intergenic
996472213 5:123874016-123874038 AAGGAGAATTAAGTTGCAGAAGG - Intergenic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997091161 5:130860269-130860291 AAGCAGCAGTAGGATGAGGGAGG - Intergenic
997418529 5:133748226-133748248 AGGGAGCAGTTGGTTGAAGAAGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997739904 5:136244184-136244206 AAGGAGGAGGAGGGAGAGGAAGG - Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997953193 5:138258147-138258169 AAAGAGGAGTAGGGTGGGGAAGG - Intronic
998192164 5:140035263-140035285 TTGGAGAAGTAGTTTGAGAAGGG - Intronic
998494934 5:142580168-142580190 AATGATAAGTAGGTTGAAAATGG + Intergenic
999318410 5:150598890-150598912 AAGGAGGGGGAGGTTGAGGTGGG + Intergenic
999993882 5:157073311-157073333 AAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1002398394 5:178976017-178976039 ATGGAGGAGTAGGGTGAGCAGGG - Intergenic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003406748 6:5832545-5832567 AAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003954297 6:11147688-11147710 AAGGAAAATTAGGCTGAGGTGGG + Intergenic
1004086741 6:12457086-12457108 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005210255 6:23452480-23452502 CAGGAGACGAAGGTTGAGCATGG - Intergenic
1006205934 6:32342896-32342918 AAGGAGAAGCAGTTAAAGGAAGG + Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006770234 6:36547110-36547132 AAGGAGTCGGAGGTTGGGGAAGG + Intronic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009268491 6:61588335-61588357 AAAGAGGAGAAGGTAGAGGAAGG - Intergenic
1010567181 6:77430578-77430600 AAGGAGAAGTTGTTGAAGGATGG - Intergenic
1010854313 6:80818662-80818684 AGGTAGAAGAAGGTTGAGGCTGG + Intergenic
1010874895 6:81090227-81090249 AAGGAGAACTAGGTATAGAATGG - Intergenic
1011002660 6:82608284-82608306 AAGGACAACAAAGTTGAGGAGGG + Intergenic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011484802 6:87830171-87830193 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1011551585 6:88535508-88535530 AAGGAGAAGTGGGTTGTGGCAGG + Intergenic
1011564089 6:88656787-88656809 AAAAAAAAGTAAGTTGAGGAAGG + Intronic
1011605011 6:89094561-89094583 AAACAGATGTAGGTTGAGTATGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013670454 6:112396696-112396718 AAGGAGAATGAGGTTGGGAAAGG - Intergenic
1014018294 6:116560034-116560056 AAATAGAAGTATGTTGTGGAAGG + Intergenic
1014044330 6:116866997-116867019 AAGGAGGAGCAGGTTGAAGAAGG - Intergenic
1014704854 6:124733159-124733181 GAGGAGAGGAAGGTTGAGTAGGG + Intronic
1014783339 6:125589533-125589555 AAGTATAAATAGGTTGATGAAGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015517225 6:134095025-134095047 AATAAGAAGTAGGAAGAGGATGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1016718743 6:147267574-147267596 AAGGAGAGGTAAGGTAAGGAAGG - Intronic
1016795628 6:148114218-148114240 AAGGAGAATTCGCTTCAGGAAGG + Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1016922859 6:149313457-149313479 AAGGAGAGGAAGGGTGACGAGGG - Intronic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017339618 6:153305375-153305397 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1017551988 6:155518793-155518815 AAGGAGAAGTGGTAAGAGGAAGG - Intergenic
1018163231 6:161068448-161068470 AAGGAGAAGAAGGTGGTGGCAGG + Intronic
1018654924 6:166025831-166025853 ACAGAGAACTAGGATGAGGATGG - Intergenic
1019812070 7:3172110-3172132 AGGGAGAAGTGGGGAGAGGAGGG + Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020410710 7:7888864-7888886 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1021295093 7:18894649-18894671 ATGGAGCAGTAGGTAGAGGGAGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1022203465 7:28139969-28139991 AAAGAGACGGAGGTTGGGGAGGG + Intronic
1022380912 7:29859234-29859256 AGGGAGAAGACGGTTGAGCAGGG + Intronic
1022446287 7:30473267-30473289 AAGGAGAGGGAGGATGAGTAAGG + Intronic
1022680264 7:32538605-32538627 GAGGAGAATGAGGTTGGGGATGG - Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023570226 7:41564238-41564260 AAGGAGAAGGTCTTTGAGGAAGG + Intergenic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024343139 7:48287133-48287155 AAAGATACGTAGGTTCAGGAAGG + Intronic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024964287 7:55008088-55008110 TAGGAGATGGAGGTTTAGGAAGG - Intergenic
1025058040 7:55780956-55780978 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027197684 7:76042352-76042374 AGGGAGCAGTTGGTGGAGGAGGG - Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027736315 7:81937069-81937091 AAGGAGGAGTAGGGTGAGCCTGG - Intergenic
1027780777 7:82517317-82517339 AAAGAGAGGAAGGTGGAGGAAGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028898416 7:96067831-96067853 TAGGAGGAGGAGGTTGGGGAAGG - Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029431804 7:100536050-100536072 AAGGAGGAGTAGGTTAGGGCAGG - Intergenic
1029470479 7:100751393-100751415 AAGGAGAGGTGTGTTGAAGATGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030324282 7:108203543-108203565 AAGGAGAAGCTGGTTCAGGGAGG - Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031097513 7:117438537-117438559 AAGGAAAAGAAGGTTGAGAATGG + Intergenic
1031208229 7:118790201-118790223 AAGAAGAAAGAGGTGGAGGAGGG + Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031959488 7:127976023-127976045 AAGGAGAACAGGGTGGAGGAGGG - Intronic
1032466830 7:132151390-132151412 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032949897 7:136895690-136895712 AGCGAGGAGTAGGGTGAGGAGGG - Intronic
1033729164 7:144157690-144157712 AAGGAGAATTAGATTTATGAGGG - Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034374517 7:150630501-150630523 AAGAAGGAGGAGGTGGAGGAAGG + Intronic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034847802 7:154463495-154463517 AAGGAGAAGTAGGCTGGGCGCGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035430329 7:158815342-158815364 TAGGAGCAGTAGTTTGAGGCTGG - Intronic
1035674337 8:1444596-1444618 ATGGAGAAGGAGGTGGAGGGAGG - Intergenic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1037187169 8:16078119-16078141 AACTAGAAGTAGGTTGTGCAAGG + Intergenic
1037231386 8:16662919-16662941 AAGGACAAGTATGTTGTGGGGGG + Intergenic
1037901190 8:22690540-22690562 AAGGAGAAGAAGGCGGAGAAGGG - Exonic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038039037 8:23708576-23708598 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1038284960 8:26198484-26198506 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1039258797 8:35748480-35748502 AGAGAGAAGTATGTAGAGGAGGG - Intronic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039814702 8:41082809-41082831 GAGGAAAAGGAGGTTGAGCAGGG + Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040356304 8:46621726-46621748 AATGAGAATTATGTTGAGAAGGG + Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041433838 8:57816666-57816688 AAGGAGACTTAGGTTTAAGATGG + Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1042247678 8:66724268-66724290 AAGGAGAAATAGGCTGGGTATGG - Intronic
1042640925 8:70933129-70933151 AAGGAGAAGTGGGTAAATGAGGG + Intergenic
1042713997 8:71751998-71752020 AAGGAGAAATGGGTTGGGAATGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1043544726 8:81302419-81302441 ATGGAGAGGTGGGTTGAGGAGGG - Intergenic
1044460988 8:92443690-92443712 AAGGAGGAGCAGGTTGGAGATGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044873065 8:96639129-96639151 AAGGAGAAGAAAGTTTAGTAGGG - Intergenic
1044972143 8:97630112-97630134 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1045130034 8:99140678-99140700 GAGGAGGAGGAGGGTGAGGAAGG - Intronic
1045173478 8:99696248-99696270 AAGAACAAGAAGCTTGAGGAAGG + Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046875293 8:119248448-119248470 AAGGAGAAGTAAGATTAGGTAGG + Intergenic
1047547002 8:125827942-125827964 AAGGAGAAGTTGGTGGTGGTTGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047836937 8:128704162-128704184 AAGGAAAATTTGGGTGAGGAAGG - Intergenic
1047958990 8:129997119-129997141 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048601354 8:135922020-135922042 ACAGAGAAATAGGATGAGGAGGG + Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051412724 9:16807539-16807561 AATGAGAAGGAGGTGGAGGGAGG + Intronic
1052821223 9:33139178-33139200 AAGGAGGAGTGGGTTGAGGTAGG + Intronic
1052971966 9:34382038-34382060 AAGGAGGAGAAGGTGGAGCAGGG + Intronic
1053407950 9:37893961-37893983 AATGACGAGTAGGTTGAAGAGGG - Intronic
1053461507 9:38274819-38274841 AAGGAGCAGGAGGCTAAGGATGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1054896834 9:70322969-70322991 AAGGACGAGTATGTTGGGGAGGG - Intronic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055326927 9:75140357-75140379 AAGGAAAAGTGGGTAGAAGATGG + Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056040517 9:82660698-82660720 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056586222 9:87929104-87929126 AAGTAGAAGCAGGTTCAGAAGGG - Intergenic
1056610660 9:88123839-88123861 AAGTAGAAGCAGGTTCAGAAGGG + Intergenic
1056743989 9:89284051-89284073 ATGGAAAAGGAGGTTGAGAAGGG - Intergenic
1057115258 9:92514840-92514862 GAGGAGGAGGAGGGTGAGGAGGG - Exonic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057851077 9:98567371-98567393 AAGCAGAGGTAGGTTAAAGAAGG - Intronic
1057896456 9:98912781-98912803 GAGGAGAAGAAGGTAGAGGAGGG + Intergenic
1058059002 9:100475073-100475095 AAGGCGGAGTAGGGGGAGGAGGG + Intronic
1058444577 9:105043431-105043453 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1059147597 9:111914903-111914925 GAACAGAAATAGGTTGAGGAAGG + Intronic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059406383 9:114100202-114100224 ATGGAGAGGTAGTTTGAGGCTGG + Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059634160 9:116155311-116155333 AGAGAGAGGGAGGTTGAGGAGGG - Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1060551821 9:124489235-124489257 AAGGAGGGGTAGGTGGAGGGTGG - Intronic
1061360445 9:130138514-130138536 GAGGAGAAAGAGGTGGAGGAGGG - Exonic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1061865695 9:133490862-133490884 AAGGAGGAGTTGGAGGAGGATGG + Intergenic
1062037363 9:134388765-134388787 AAGGAGGAGGAGGCAGAGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203461064 Un_GL000220v1:38383-38405 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185591635 X:1281152-1281174 AAGGAGGAGTAGGAGGAGAAGGG - Intronic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186027814 X:5333110-5333132 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186124716 X:6400918-6400940 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186645476 X:11502600-11502622 GAGGAAAAGGAGGTCGAGGAGGG - Intronic
1187561209 X:20405451-20405473 CACGAGAAGAAGGTTGGGGAGGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188702095 X:33277663-33277685 AAGGAGTAGGAGGCTGAGGGTGG - Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1190221812 X:48516747-48516769 GAGCAGAGGTAGGGTGAGGAGGG + Intronic
1192430949 X:71111259-71111281 AAGAAGAAGTAGCGTGAGGCAGG + Intronic
1192431056 X:71111846-71111868 GAGGAGAAGGTGGTTGAGAATGG - Intronic
1192929076 X:75785550-75785572 GAGGAGCAGAAGGTGGAGGAAGG + Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194312594 X:92331349-92331371 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1195006686 X:100692096-100692118 AAGCAGGAGTAGATTGAGGCAGG - Intronic
1195235815 X:102897227-102897249 AAGGAGAAGAAGGATAAGGGAGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195756600 X:108205028-108205050 AAGGAGGAGGAAGTGGAGGAGGG + Intronic
1195813738 X:108862592-108862614 ATGGCGGAGTAGGTTGATGATGG - Intergenic
1195860864 X:109381370-109381392 GAGGTGAAGTAGTTTGAGCAGGG - Intronic
1197390632 X:125859450-125859472 AAGAAGTGGTAGATTGAGGAAGG + Intergenic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1198778081 X:140202283-140202305 AAGGACAAGGAGGTTAAGGAAGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199818891 X:151424732-151424754 AAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200620857 Y:5445495-5445517 AAGGAGGAGGAGGAAGAGGAGGG - Intronic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201258285 Y:12132144-12132166 AAGGAAAAGGAGGGAGAGGAAGG + Intergenic
1201453001 Y:14136300-14136322 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic