ID: 1099403268

View in Genome Browser
Species Human (GRCh38)
Location 12:82226337-82226359
Sequence TGTATTGGCAGGGATATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099403268_1099403276 26 Left 1099403268 12:82226337-82226359 CCCAGTATATCCCTGCCAATACA 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1099403276 12:82226386-82226408 GCAATCTAATAGGTGAAAAATGG 0: 1
1: 3
2: 5
3: 79
4: 439
1099403268_1099403275 16 Left 1099403268 12:82226337-82226359 CCCAGTATATCCCTGCCAATACA 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1099403275 12:82226376-82226398 TTTAGTTTCTGCAATCTAATAGG 0: 1
1: 0
2: 0
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099403268 Original CRISPR TGTATTGGCAGGGATATACT GGG (reversed) Intronic
905775262 1:40664223-40664245 TGGGTTGGCAGGGATGTGCTGGG - Intronic
905795280 1:40812582-40812604 TACATTTGAAGGGATATACTTGG - Intronic
911819738 1:102402435-102402457 TGTATTGGGAGGGATAGCATTGG - Intergenic
913468397 1:119166596-119166618 TGTATTGGCTGGGATGAAATGGG + Intergenic
918350941 1:183654989-183655011 TGTATTGGAAAGGAGATGCTTGG + Intronic
918520854 1:185413296-185413318 TGTAATGACAGGGATATGTTCGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063707448 10:8444590-8444612 TGTGTTTCCAGGGTTATACTTGG - Intergenic
1064441456 10:15357461-15357483 AGTAGAGGCAGGGATTTACTAGG + Intronic
1067241610 10:44499878-44499900 TGTATTGGCATGGATTTATTTGG - Intergenic
1067823799 10:49554729-49554751 TGTATGAGAAGGGATTTACTAGG + Intergenic
1074166525 10:110882246-110882268 TCTGATGGCAAGGATATACTTGG + Intronic
1074627709 10:115211506-115211528 TGTCTTGGCATGGATATCTTTGG + Intronic
1075361482 10:121839211-121839233 AGTATTTGCAGGGATATACAAGG + Intronic
1077838771 11:5949335-5949357 TGTATGGGCAGTAAGATACTTGG + Intergenic
1078730537 11:13970200-13970222 TGTTTTGGCAGGGATGGAGTTGG + Intronic
1078888329 11:15528331-15528353 TTTTTTGGTAGTGATATACTTGG - Intergenic
1078993567 11:16673472-16673494 TTTATTGGCATACATATACTTGG - Intronic
1080670829 11:34375871-34375893 TGTTTTGGCAGTGATTTACTTGG + Intergenic
1091905508 12:4184382-4184404 TGTTTCTGCAGGCATATACTAGG + Intergenic
1093855915 12:24102020-24102042 TGTTATGTCAGGGTTATACTTGG - Intergenic
1099403268 12:82226337-82226359 TGTATTGGCAGGGATATACTGGG - Intronic
1104598328 12:130134778-130134800 TGCATCAGCAGGGATATGCTGGG - Intergenic
1108089701 13:46835621-46835643 GGTATTGGCATGGATATACCTGG + Exonic
1109570566 13:64183507-64183529 TGTAGTGGAAAGGATATATTGGG - Intergenic
1110087246 13:71395708-71395730 TGTATTGACAGATATATATTAGG - Intergenic
1110093377 13:71483890-71483912 TGTATAGACAGGTATATACTAGG + Intronic
1111070912 13:83167053-83167075 TGTCTTGGCAGGAATAAACTGGG - Intergenic
1111665270 13:91259629-91259651 CTTATTTGCAGGGACATACTAGG + Intergenic
1113295151 13:108951479-108951501 TTAATTGGCAGGGATATCCTGGG - Intronic
1114506073 14:23214898-23214920 TGTCTTGGCATGGATTTATTTGG - Intronic
1117890856 14:60420453-60420475 TGAAATGGCAGGGAAATATTAGG + Intronic
1120921687 14:89761199-89761221 TGAATGGGCAGGGAGAAACTGGG + Intergenic
1121243181 14:92444270-92444292 TGTTTTGGCACGGATATGCCAGG + Intronic
1123203054 14:106685330-106685352 TTTATTGGCAGAGACACACTGGG - Intergenic
1124403104 15:29367571-29367593 TGTATTCCCAGAGATATATTGGG - Intronic
1129172438 15:73816474-73816496 GGTACTGGCAGGGATCTCCTGGG + Intergenic
1132249230 15:100321589-100321611 AGTATTGGCAGGGATAAAAATGG + Intronic
1138998395 16:62479178-62479200 TGCATTGGCAGGCATAAGCTTGG + Intergenic
1139479971 16:67225312-67225334 TGTATTAGCAAGGATGAACTTGG - Intronic
1141264493 16:82484051-82484073 TGTCTTGGCATGGATTTCCTTGG - Intergenic
1142821636 17:2473087-2473109 TGTGGGGGCAGGGATATACAGGG + Intronic
1144268429 17:13594098-13594120 TGTTTTCTCAGGGCTATACTGGG + Intronic
1147934001 17:44001214-44001236 TGTATTGGGAGGGAAAGCCTTGG + Intronic
1156172630 18:34504797-34504819 TGTCTTGACATGGATATCCTTGG + Intronic
1165621950 19:37255542-37255564 TGTGTTGGCAGGGCTAGTCTTGG + Intergenic
926989123 2:18658021-18658043 TGTTTGGGGAGGGAGATACTTGG - Intergenic
929132587 2:38592786-38592808 TGTATAGACAGGGATGTACACGG - Intronic
930608517 2:53516787-53516809 TGTGAGGGCAGGGATATACCCGG - Intergenic
932079537 2:68699169-68699191 TGTATTGGCAGGGAGGTTTTGGG - Intronic
934760033 2:96849801-96849823 TAGATTGGCAGGGAAAGACTGGG + Intronic
935148436 2:100412479-100412501 TGTCTTGGCTGGGGTATTCTTGG - Intronic
937585970 2:123550399-123550421 GATTTTGGCAGGAATATACTAGG + Intergenic
939875853 2:147577023-147577045 TGTAGTTGCAGGCATTTACTGGG + Intergenic
942395945 2:175549624-175549646 GGTATTGGCAGGGAAAGACAAGG + Intergenic
946677955 2:222182355-222182377 TGAGTTTGCATGGATATACTTGG + Intergenic
1171387135 20:24778134-24778156 TGTGTTGACAGGGATCTCCTGGG - Intergenic
1175632648 20:60555312-60555334 TGTCTTGGCAGGGAGACACAGGG - Intergenic
1176342045 21:5708124-5708146 TGTCTTTGCAGGCACATACTCGG + Intergenic
1176474299 21:7140276-7140298 TGTCTTTGCAGGCACATACTCGG + Intergenic
1176502782 21:7616332-7616354 TGTCTTTGCAGGCACATACTCGG - Intergenic
1176536366 21:8106193-8106215 TGTCTTTGCAGGCACATACTCGG + Intergenic
1176997513 21:15573640-15573662 TGTCTTGGTGGGGATATACTTGG - Intergenic
1177883438 21:26720591-26720613 AGTATTGGCAGGAATATTGTAGG + Intergenic
1178427675 21:32491957-32491979 GGTAGTGGCAGGGATGGACTTGG + Intronic
1182392673 22:30012241-30012263 TGTTTTGGCAGTGTTATATTTGG + Intronic
1203241309 22_KI270733v1_random:22605-22627 TGTCTTTGCAGGCACATACTCGG + Intergenic
953408951 3:42677765-42677787 TGTCTTGGCATGGATTTATTTGG + Intergenic
957342149 3:78914529-78914551 AGTAGTGTCAGGGAAATACTTGG - Intronic
965288324 3:166844837-166844859 TGCAATGGCAAGGATATACAAGG - Intergenic
965835606 3:172848508-172848530 TTTACTGGCTGGGATATCCTTGG + Intergenic
967417650 3:189236702-189236724 TATAATGGCAGGCATATACTAGG + Intronic
978104499 4:104884811-104884833 TGTCTTGGTAGGGATAAACTGGG + Intergenic
983871505 4:172829346-172829368 AGTATTGGTAGGGATACTCTGGG + Intronic
984861817 4:184247033-184247055 TCTATTGGGAGGGATATTTTGGG - Intergenic
985655873 5:1131122-1131144 TGTATTCGCAGGGACACACAGGG + Intergenic
991917221 5:71616964-71616986 TGTATGGGAAAGGATAGACTAGG - Intronic
995262570 5:110122662-110122684 TGTCATGGGAGGGATATAGTGGG + Intergenic
1004259883 6:14098593-14098615 CGTAGTGGAAGGGATATATTTGG + Intergenic
1005306665 6:24520780-24520802 TTTATTACCAGGGTTATACTAGG + Intronic
1008179496 6:48310857-48310879 TACATTGGCAGGGAAATTCTAGG - Intergenic
1008406922 6:51128596-51128618 TGTATGGTCAGAGATATACATGG - Intergenic
1009354217 6:62721089-62721111 TGTATTAACAGGAATATATTTGG - Intergenic
1014508034 6:122282881-122282903 TGTTTTGTCATGAATATACTGGG - Intergenic
1014541488 6:122681269-122681291 TGTTTGGGCAGGCATATAATTGG + Intronic
1020458842 7:8405320-8405342 TGTGTTGTCATGGATAGACTGGG + Intergenic
1028095082 7:86750174-86750196 TGCATTGCCAGGCATATATTAGG - Intronic
1029103595 7:98155473-98155495 TGTCTTGGCATGGATTTCCTTGG - Intronic
1031250760 7:119377687-119377709 TGTGTTGGCAGGCATTAACTTGG + Intergenic
1032613560 7:133442181-133442203 TGTTTTAGAAAGGATATACTGGG + Intronic
1042746321 8:72111183-72111205 AGTATTGGCAGGCATATTTTAGG + Intronic
1051310107 9:15761201-15761223 TGTACTAGCAGGGGTATATTTGG - Intronic
1051956853 9:22705935-22705957 TGTGTTGTGAGGGATACACTGGG + Intergenic
1052436597 9:28437503-28437525 TGTATAGGAAGGGATTTATTAGG - Intronic
1052896976 9:33756381-33756403 TTTTTTGGCAGGGAGATACAGGG + Intronic
1055504547 9:76934442-76934464 TTGTTTGGCAGGGATATAATTGG + Intergenic
1055841654 9:80512549-80512571 TGTCTTGGTAGGAATAAACTGGG + Intergenic
1057140254 9:92722495-92722517 TGTGGAGGCAGGGGTATACTTGG - Intronic
1058934697 9:109758052-109758074 TGTATTTGCTTGTATATACTTGG - Intronic
1189868931 X:45361542-45361564 TGTCTTTGCAGGGGTATAATTGG + Intergenic
1190336510 X:49266036-49266058 TGTGATGGCAGGGAGATCCTGGG + Intergenic
1193433854 X:81447465-81447487 TTTTTTAGCAGGGATATAATTGG + Intergenic
1194386436 X:93261255-93261277 TTAATTGGGAGGGATATATTGGG - Intergenic
1202278793 Y:23154978-23155000 TATTTTGACAGGAATATACTTGG - Intronic
1202279094 Y:23159757-23159779 TATTTTGACAGGAATATACTTGG - Intronic
1202285340 Y:23237073-23237095 TATTTTGACAGGAATATACTTGG + Intronic
1202285643 Y:23241851-23241873 TATTTTGACAGGAATATACTTGG + Intronic
1202285946 Y:23246631-23246653 TATTTTGACAGGAATATACTTGG + Intronic
1202286411 Y:23253786-23253808 TATTTTGACAGGAATATACTTGG + Intronic
1202431617 Y:24786318-24786340 TATTTTGACAGGAATATACTTGG - Intronic
1202431920 Y:24791075-24791097 TATTTTGACAGGAATATACTTGG - Intronic
1202432223 Y:24795831-24795853 TATTTTGACAGGAATATACTTGG - Intronic
1202437743 Y:24862307-24862329 TATTTTGACAGGAATATACTTGG + Intronic
1202438045 Y:24867087-24867109 TATTTTGACAGGAATATACTTGG + Intronic
1202438348 Y:24871844-24871866 TATTTTGACAGGAATATACTTGG + Intronic