ID: 1099413635

View in Genome Browser
Species Human (GRCh38)
Location 12:82361352-82361374
Sequence ACCTAGTGGATCCCACGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 3, 2: 28, 3: 131, 4: 459}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099413627_1099413635 7 Left 1099413627 12:82361322-82361344 CCCACTAGACTCAGGAGCCCAGC 0: 205
1: 1041
2: 602
3: 288
4: 498
Right 1099413635 12:82361352-82361374 ACCTAGTGGATCCCACGTTGGGG 0: 1
1: 3
2: 28
3: 131
4: 459
1099413625_1099413635 14 Left 1099413625 12:82361315-82361337 CCAAGTCCCCACTAGACTCAGGA 0: 190
1: 436
2: 1123
3: 848
4: 853
Right 1099413635 12:82361352-82361374 ACCTAGTGGATCCCACGTTGGGG 0: 1
1: 3
2: 28
3: 131
4: 459
1099413631_1099413635 -10 Left 1099413631 12:82361339-82361361 CCCAGCTGGCTTCACCTAGTGGA 0: 373
1: 1084
2: 559
3: 192
4: 145
Right 1099413635 12:82361352-82361374 ACCTAGTGGATCCCACGTTGGGG 0: 1
1: 3
2: 28
3: 131
4: 459
1099413628_1099413635 6 Left 1099413628 12:82361323-82361345 CCACTAGACTCAGGAGCCCAGCT 0: 210
1: 1062
2: 593
3: 293
4: 485
Right 1099413635 12:82361352-82361374 ACCTAGTGGATCCCACGTTGGGG 0: 1
1: 3
2: 28
3: 131
4: 459
1099413626_1099413635 8 Left 1099413626 12:82361321-82361343 CCCCACTAGACTCAGGAGCCCAG 0: 190
1: 1041
2: 578
3: 288
4: 557
Right 1099413635 12:82361352-82361374 ACCTAGTGGATCCCACGTTGGGG 0: 1
1: 3
2: 28
3: 131
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099413635 Original CRISPR ACCTAGTGGATCCCACGTTG GGG Intronic
900113195 1:1018249-1018271 ACCCAGTGGATCCCGCACTGGGG + Intergenic
902032541 1:13433784-13433806 ACCCAGTGGATCCCACACCGGGG + Intergenic
904238814 1:29131081-29131103 ACCCAGTGGATCCCACACCGGGG + Intergenic
905375707 1:37518675-37518697 ACCTAGTGGATCCCGCACCGGGG - Intergenic
906877635 1:49556645-49556667 GCCTAGTGGATCCCGCGCAGGGG + Intronic
909317950 1:74247837-74247859 GCCTAGTAGATCCCACGCAGGGG + Intronic
910550375 1:88467492-88467514 ACCTAGTGGATCCGGCACTGGGG - Intergenic
910609677 1:89127978-89128000 ACCTAGTGGATCCCGCACAGGGG + Intronic
911305156 1:96224275-96224297 ACCTAGTGGATCCCACGCTGGGG + Intergenic
911954423 1:104217381-104217403 ACCTAGTGGATCCCGCACTGGGG + Intergenic
912312799 1:108640806-108640828 ACCTAGTGGATCCCGCACCGGGG + Intronic
913160989 1:116146491-116146513 ACCCAGTGGATCCCGCACTGGGG + Intergenic
914340094 1:146752966-146752988 ACTTGCTGGATACCACGTTGAGG + Intergenic
915260142 1:154671185-154671207 ACCCAGTGGATCCCACATCAGGG - Intergenic
915261312 1:154678472-154678494 ACCCAGTGGATCCCACATCAGGG - Intergenic
915764412 1:158348926-158348948 ACCTAGTGGATCCTGCACTGGGG + Intergenic
916940141 1:169668434-169668456 ACCCAGTGGATCCCACGCCGGGG - Intronic
916960362 1:169882534-169882556 ACCCAGTGGATCCCGCACTGGGG - Intronic
916991538 1:170250658-170250680 ACCTAGTGGATCCCACGCAGGGG + Intergenic
917093909 1:171381603-171381625 ACCTAGTGGATCCCATGCTGGGG + Intergenic
917348790 1:174056346-174056368 ACCCAGTGGATCCCGCACTGGGG + Intergenic
917445335 1:175102237-175102259 ACCCAGTGGATCCCGCACTGGGG + Intronic
917446291 1:175108394-175108416 ACCGAGTGGATCCCGCACTGGGG + Intronic
918059089 1:181046252-181046274 ACCCAGTGGATCCCCCACTGGGG - Intronic
918790047 1:188813442-188813464 ACCCAGTGGATCCCGCACTGGGG - Intergenic
919419696 1:197355332-197355354 AGCTAGTGGATCCCACGCAGGGG + Intronic
920731293 1:208488375-208488397 ACCCAGTGGATCCCACACTGGGG + Intergenic
920883075 1:209898738-209898760 ACCTAGTGGATCCCGCACCGGGG + Intergenic
922166058 1:223116899-223116921 GCCTAGTGGATCCCGCGTCAGGG + Intronic
922423289 1:225473130-225473152 ACCTAGTGGATCCCGCACCGGGG - Intergenic
923172528 1:231430756-231430778 ACCCAGTGGATCCCGCACTGGGG + Intergenic
923353262 1:233129543-233129565 ACCCAGTGGATCCCACACTGAGG - Intronic
924313696 1:242774306-242774328 GCCTAGTGGATCCCGTGCTGGGG + Intergenic
1063322121 10:5060624-5060646 ACTCAGTGGATCCCACACTGGGG + Intronic
1063885180 10:10570066-10570088 ATCTAGTGCCTCCCACATTGAGG + Intergenic
1064197865 10:13260029-13260051 ACCTAGTGGATCCGGCACTGGGG - Intergenic
1065983774 10:30930000-30930022 ACCTAGTGGATCCCTCGCCAGGG + Intronic
1066186378 10:33013715-33013737 ACCTAGTGGATCCCGCACTGGGG - Intergenic
1066234124 10:33468456-33468478 ACCTAGTGGATCCCACACCGGGG - Intergenic
1066567322 10:36734556-36734578 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1066568771 10:36748739-36748761 GCCTAGTGGATCCCATGTCGGGG - Intergenic
1067093813 10:43285588-43285610 AGCCAGTGGATGCCAGGTTGCGG + Intergenic
1068211405 10:53924602-53924624 ACCTAGTGGATCCTGCACTGGGG - Intronic
1068216757 10:53991235-53991257 GGCTAGTGGATCCCACGCCGGGG - Intronic
1068554883 10:58448193-58448215 ACCTAGTGGATCCTGCGCAGGGG + Intergenic
1068902194 10:62280801-62280823 ACCTAGTGGATCCCACACCAGGG - Intergenic
1070937961 10:80315824-80315846 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1070942490 10:80359434-80359456 ACCTAGTGGATCCCGCATCAGGG + Intronic
1070968384 10:80543637-80543659 ACCCAGTGGATCCCGCACTGGGG - Intronic
1071078789 10:81784641-81784663 ACCTAGTGGATCCTGCACTGGGG - Intergenic
1071900930 10:90119767-90119789 ACCCAGTGGATCCCACACCGGGG + Intergenic
1072271208 10:93779183-93779205 ATCTAGTGGATTTCAAGTTGAGG - Intronic
1073262418 10:102200831-102200853 GCCTAGTGGATCCCTCGCCGGGG + Intergenic
1073399420 10:103244632-103244654 ACCTAGAGGAACCGATGTTGAGG - Intergenic
1074098214 10:110331889-110331911 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1075269305 10:121035276-121035298 ACCTAGTGGATCCCACACTGGGG + Intergenic
1075305786 10:121365953-121365975 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1075307696 10:121382542-121382564 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1077764673 11:5144819-5144841 ACCCAGTGGATCCCACACCGGGG - Intergenic
1077805843 11:5590302-5590324 ACCTAGTGGATCCCACACAGGGG - Intronic
1078251824 11:9622972-9622994 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1078301122 11:10133241-10133263 ACCTAGTGGATCCCGCGTAGGGG + Intronic
1078743614 11:14091264-14091286 ACCTAGTGGATCCCGCACCGGGG + Intronic
1078795901 11:14591488-14591510 ACCCAGTGAATCCCACACTGGGG - Intronic
1079767693 11:24415938-24415960 ACCCAGTGGATCCCACACTGGGG + Intergenic
1080195124 11:29600085-29600107 ACCTAGTGGATCCTACACCGGGG + Intergenic
1080223582 11:29934559-29934581 ACCTAGTGGATCCCACGCCTGGG - Intergenic
1080621525 11:33990522-33990544 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1081125138 11:39312255-39312277 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1081318404 11:41660287-41660309 ACATAGTGGCTTCCACGCTGAGG - Intergenic
1081422146 11:42881806-42881828 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1081869392 11:46376439-46376461 CCCTAGGGGATCCCAGGTAGGGG + Intronic
1082272197 11:50183697-50183719 ACCCAGTGGATCCCGCCCTGGGG - Intergenic
1084107489 11:66989216-66989238 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1084792451 11:71483119-71483141 ACATAGTGGATGACACGATGCGG - Intronic
1085671015 11:78464907-78464929 ACCCAGTGGATCCCACACTGGGG + Intronic
1087441109 11:98185152-98185174 GCCTAGTGGATCCTGCGCTGGGG + Intergenic
1087682269 11:101231272-101231294 ACCTAGTGGATCCCACACCAGGG + Intergenic
1090229305 11:125089920-125089942 ACCTAGTGGATCCCGCACCGGGG - Intronic
1090307604 11:125704639-125704661 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1090558067 11:127898507-127898529 TCCTATTGGATCCCATGCTGGGG + Intergenic
1091402171 12:188054-188076 ACCCAGTGGATCCCTCACTGGGG + Intergenic
1092101625 12:5888832-5888854 ACCCAGTGGATCCCACACTGGGG + Intronic
1092220364 12:6708705-6708727 ACCTAGAGGATCCCACGCTGGGG - Intergenic
1092410856 12:8252128-8252150 ACCAAGTGGGTCCCACATGGGGG + Intergenic
1092497701 12:9012928-9012950 ACCTAGTGCACTCCAAGTTGTGG + Intergenic
1092617069 12:10225550-10225572 ACCCAGTGGATCCCACACCGGGG + Intergenic
1093034582 12:14320517-14320539 ACCCAGTGGATCCCGCAATGGGG - Intergenic
1093266354 12:17008047-17008069 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1093381640 12:18500568-18500590 ACCCAGTGGATCTCGCATTGGGG - Intronic
1093527014 12:20115167-20115189 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1093741295 12:22692975-22692997 GCCTAGTGGATGCCGCGCTGGGG + Intergenic
1094405283 12:30110419-30110441 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1094589223 12:31805726-31805748 ACCTAGTGGATCCCGCACCGTGG + Intergenic
1094661362 12:32472715-32472737 ACCTAGTGGATCCCGCACCGGGG - Intronic
1094666563 12:32526095-32526117 ACCTAGTGGATCCCGCACCGGGG - Intronic
1095534039 12:43224703-43224725 ACCCAGTGGATGCCACACTGGGG - Intergenic
1095776779 12:46018440-46018462 ACCTAGTGGATCCCGCACGGGGG - Intergenic
1097128861 12:56795776-56795798 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1098588754 12:72185469-72185491 ACCTAGTGGATCCCGCACAGGGG - Intronic
1098759320 12:74403371-74403393 ACCTAGTGGATCCCACACCGGGG - Intergenic
1099191474 12:79565377-79565399 ACCCAGTGGATCCCACACCGGGG - Intergenic
1099413635 12:82361352-82361374 ACCTAGTGGATCCCACGTTGGGG + Intronic
1099443898 12:82729146-82729168 ACCCAGTGGATCCCGCACTGGGG - Intronic
1099523866 12:83696232-83696254 ACCTGGTGGATCCCTCACTGGGG + Intergenic
1099716155 12:86296339-86296361 ACCTAGTGGATCCCACACCAGGG + Intronic
1100166542 12:91923845-91923867 ACCCAGTGGATCCCACACCGGGG + Intergenic
1100521532 12:95380008-95380030 ACCTAGTGGATCCCGCACCGGGG - Intronic
1100584771 12:95969557-95969579 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1101461887 12:104905449-104905471 ACCTAGTGGATCCCGCACCGGGG + Intronic
1103760794 12:123249258-123249280 GCCTACTGGATCCCATGCTGGGG + Intronic
1103853366 12:123947384-123947406 ACCCAGTGGATCCCACACCGGGG - Intronic
1104582718 12:130022478-130022500 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1104614439 12:130256591-130256613 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1105037829 12:132939177-132939199 ACCTAGTGGATCCCGCACCGGGG - Intronic
1105477319 13:20739868-20739890 ACCTAGTGGATCCAGCACTGGGG + Intronic
1105722248 13:23127994-23128016 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1105762076 13:23524508-23524530 GCCTAGTGGATCCCACATCGGGG - Intergenic
1106616988 13:31339602-31339624 ACCTAGTGGATCCCACACTGGGG + Intergenic
1106811024 13:33358404-33358426 ATCTAGTGGATCCCACACCGGGG - Intergenic
1106840723 13:33682513-33682535 GCCTAGTGGATCCCACACCGGGG - Intergenic
1107259306 13:38472367-38472389 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1108099104 13:46935992-46936014 ACCTAGTGGATCCCACACCAGGG + Intergenic
1108851539 13:54737213-54737235 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1108991064 13:56659047-56659069 CCCTAGTGGATCCCACACTGGGG + Intergenic
1109110937 13:58318472-58318494 ACCTAGTGGATCCCCCACTGGGG + Intergenic
1109141124 13:58714506-58714528 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1109364710 13:61339583-61339605 ACCCAGTGGATCCCTCACTGGGG - Intergenic
1109441442 13:62379652-62379674 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1110417554 13:75268872-75268894 ACCTAGTGGATCCCATACTGGGG - Intergenic
1110999765 13:82164884-82164906 ACCCAGTGGATCTCACACTGGGG + Intergenic
1111748403 13:92297089-92297111 ACCTAGTGGATCCCGCACAGGGG - Intronic
1112077669 13:95931374-95931396 ACCTAGTGGATCCCACACCTGGG + Intronic
1112226587 13:97545708-97545730 ACCCAGTGGATCCCACATGGGGG - Intergenic
1112705929 13:102068897-102068919 ACCTAGTGGATCCTGCACTGGGG - Intronic
1113506710 13:110821583-110821605 ACCTAGTGGATCCCACACCGAGG - Intergenic
1113678129 13:112222140-112222162 ACCTAGTGGATCCCACACCGAGG - Intergenic
1114957845 14:27845797-27845819 GCCTAGTGGATCCCGCGCTGGGG - Intergenic
1115268551 14:31527021-31527043 ACCTAGTGGATCCTGCCCTGGGG + Intronic
1116152042 14:41154186-41154208 GCCTAGTGGATCCCGCGGTAGGG + Intergenic
1116452440 14:45080859-45080881 ACCCAGTGGATCCCGCTCTGGGG - Intergenic
1116624091 14:47242867-47242889 ACCTAGTGGATCCCACACCGGGG - Intronic
1117571850 14:57056553-57056575 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1118215294 14:63803201-63803223 ACCTAGTGGATCCCCCACCGGGG + Intergenic
1118558837 14:67056664-67056686 ACCTAGTGGATCACACGCCAGGG + Intronic
1119027849 14:71167916-71167938 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1119486857 14:74994572-74994594 ACCTAGTGGATCCCGCACTGGGG - Intergenic
1120439029 14:84512845-84512867 ACCCAGTGGATCCCACACCGGGG + Intergenic
1121145476 14:91578397-91578419 GCCTAGTGGATCCCACGCCAGGG - Intergenic
1122493381 14:102135448-102135470 ACCTAGTGGATCCCGCACCGGGG + Intronic
1122514613 14:102298112-102298134 ACCTAGTGGATCCCACACCAGGG - Intronic
1122894748 14:104751461-104751483 ACCTAGTGGATCCCACACCGGGG + Intergenic
1123825503 15:24078372-24078394 GCCTAGTGGATCCCACGCCTGGG + Intergenic
1123949054 15:25253130-25253152 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1124061518 15:26298015-26298037 ACCTAGTGGATCCCACAGCCAGG + Intergenic
1124562026 15:30783130-30783152 ACCTAGTGGATCCCACGCCAGGG + Intergenic
1124573205 15:30884180-30884202 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1125480214 15:40074710-40074732 ACCTAGTGGATCCCGCAATGGGG + Intergenic
1125609776 15:40962042-40962064 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1125885474 15:43226525-43226547 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1126128162 15:45314521-45314543 ACCCAGTGGATCCCGCATGGGGG - Intergenic
1129196999 15:73974132-73974154 ACCCAGTGGATCCCACACGGGGG - Intergenic
1129746295 15:78023756-78023778 ACCTAGTGGATGCCTGGTTTGGG - Intronic
1129859245 15:78847297-78847319 ACCTAGTGGATCCCGCACGGGGG - Intronic
1129885849 15:79036466-79036488 ACCTGGTGTTTCCCACCTTGGGG + Intronic
1129997220 15:80016901-80016923 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1130814619 15:87418202-87418224 CTCTAGTGGATCCTAAGTTGGGG + Intergenic
1131507862 15:93032251-93032273 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1133352090 16:5108488-5108510 ACCAAGTGGATCCCGCCCTGGGG + Intergenic
1135262047 16:20989579-20989601 ACCTAGTGGATCCCGCACCGGGG + Intronic
1138693525 16:58790706-58790728 ACCCAGTGGATCCCACACCGGGG + Intergenic
1138889794 16:61128697-61128719 GCCTAGTGGATCCCATGCTGGGG + Intergenic
1139919514 16:70450731-70450753 ACTCAGTGGATCCCGCATTGGGG + Intergenic
1139994194 16:70964442-70964464 ACTTGCTGGATGCCACGTTGAGG - Intronic
1140036547 16:71375800-71375822 ACAGAGTGGGTCCCACTTTGAGG + Intronic
1140722443 16:77784321-77784343 ACCTAGTGGATCCCGCATGGGGG + Intergenic
1142505743 17:362017-362039 ACCTAGTGGATCCCGCACCGGGG - Intronic
1143135199 17:4709033-4709055 ACCCAGTGGATCCCGCTTGGGGG + Intergenic
1143664199 17:8347055-8347077 ACCCAGTGGATCCCACACCGGGG + Intergenic
1143708575 17:8718014-8718036 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1144467224 17:15506112-15506134 ACCTAGTGGATCCCGCACCGGGG - Intronic
1144723282 17:17486776-17486798 ACCTAGTGGATCCCGCACCGGGG - Intronic
1145050220 17:19654249-19654271 GCCTAGTGGATCCCACGCCGGGG + Intronic
1148023447 17:44568608-44568630 ACCCAGTGGATCCCGCATCGGGG - Intergenic
1148366102 17:47057221-47057243 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1150772354 17:68052295-68052317 ACCCAGTGGATCCCACAGCGGGG - Intergenic
1150775890 17:68081038-68081060 ACCCAGTGGATCCCACATGGGGG - Intergenic
1150792310 17:68208237-68208259 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1151782595 17:76257584-76257606 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1152197889 17:78928306-78928328 ACCTGGTGGAGCCCATGGTGTGG + Intergenic
1153665124 18:7361061-7361083 AGCTAGTAGATCCCACCCTGGGG - Intergenic
1154231079 18:12557083-12557105 ACCTAGTGGATCCCGCGTTGGGG + Intronic
1154294038 18:13134622-13134644 ACCTAGTGGATCCCACAGTGGGG + Intergenic
1155207970 18:23577566-23577588 ACCTAGTGGATCCCGCACCGGGG + Intronic
1155294957 18:24376516-24376538 ACCCAGTGGATCCCGCACTGGGG + Intronic
1155772949 18:29723941-29723963 ACCTAGTGGATCCCACACCGGGG - Intergenic
1155856304 18:30839095-30839117 ACCTAGTGGATCCCTCACTGGGG + Intergenic
1156969751 18:43139943-43139965 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1157086042 18:44581157-44581179 ACCTAGTGGATCCCACACCGGGG - Intergenic
1158697184 18:59714029-59714051 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1158699707 18:59735063-59735085 AGCAAGTGGATTCCACGTTCTGG + Intergenic
1158705678 18:59790392-59790414 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1159167878 18:64725576-64725598 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1160176542 18:76600067-76600089 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1160198632 18:76777668-76777690 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1160224889 18:77005006-77005028 ACCTTGTGGGACCCACATTGGGG + Intronic
1162045265 19:7995422-7995444 ACCTAGAGGATACCACACTGTGG - Intronic
1162233030 19:9283389-9283411 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1162261982 19:9541263-9541285 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1164310533 19:24041738-24041760 ACCTAGTGGATCCCGCACCGGGG - Intronic
1164582043 19:29440440-29440462 GCCTAGTGGATCCTGCGCTGGGG - Intergenic
1165191236 19:34065627-34065649 ACCTATTGGAGCCCTCTTTGTGG + Intergenic
1165415458 19:35691033-35691055 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1166036141 19:40170077-40170099 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1166486937 19:43221858-43221880 ACCCAGTGGATCCCACACTGGGG + Intronic
1167706499 19:51084221-51084243 ACCTAGCAGATCCCAAGCTGGGG - Exonic
1168672851 19:58254549-58254571 CCCTAGAGGATCCCCCTTTGGGG + Intronic
925172519 2:1759238-1759260 GCCTAGTGGATCCCACGCCAGGG + Intergenic
927357152 2:22186722-22186744 ACCCAGTGGATCCCGCACTGGGG - Intergenic
928015349 2:27651215-27651237 ACTTAGTGGTTCTCACATTGTGG + Exonic
928723041 2:34142471-34142493 GCCTAGTGGATCCCACGCCAGGG + Intergenic
928880654 2:36092664-36092686 ACCTAGTGGATCCCGCACCGGGG - Intergenic
929890790 2:45917607-45917629 ACCCAGTGGATCCCGCACTGGGG + Intronic
930420805 2:51151551-51151573 ACCTAGTGGACCCCACACTGGGG + Intergenic
930605237 2:53486453-53486475 ACCTAGTGGATCCTGCACTGGGG - Intergenic
931708767 2:64969428-64969450 ACCCAGTGGATCCCACTCTGGGG - Intergenic
932240005 2:70148729-70148751 ACCCAGTGGATCCCACACTGGGG - Intergenic
932486553 2:72087305-72087327 ACCTAGTGGATCCCGCACCGGGG - Intergenic
932521849 2:72422250-72422272 CCCTAGTGGATCCCGCACTGGGG - Intronic
932902122 2:75711998-75712020 ACCTAGTGGATCCCGCACCGGGG - Intergenic
933049994 2:77590896-77590918 ACCCAGTGGATCCCACAGGGAGG - Intronic
933415896 2:81985581-81985603 ACCTAGTGGATCCCGTGCAGGGG - Intergenic
933511392 2:83245903-83245925 ACCCAGTGGATCCCGCATGGGGG + Intergenic
934479458 2:94622137-94622159 GCCTAGCGGATCCCGCGCTGGGG + Intergenic
934898569 2:98139426-98139448 ACCCAGTGGATCCCACACAGGGG - Intronic
935942807 2:108258969-108258991 ACCTTGTGGATCTCATGTTTTGG - Intronic
936511195 2:113149047-113149069 ACCCAGTGCATTCCAAGTTGTGG - Intergenic
937209521 2:120259687-120259709 ACCTAGTGGATCCCGCACCGGGG + Intronic
937596923 2:123684199-123684221 ACCTAGTGGATCCCACACCGGGG - Intergenic
937746670 2:125422672-125422694 ACCTAGTGGATCCCACACTGGGG - Intergenic
939738695 2:145880840-145880862 ACCCAGTGGATCCCGCACTGGGG + Intergenic
939777285 2:146403628-146403650 ACCTAGTGGATCCCGCACTGGGG + Intergenic
939886367 2:147686200-147686222 GCCTAGTGGATCCCACGCCATGG + Intergenic
940361859 2:152804750-152804772 ATCTAGTGGATCCTGCATTGGGG + Intergenic
940666629 2:156617971-156617993 ACCCAGTGGATCCCGCACTGGGG + Intergenic
941705797 2:168657375-168657397 ACCTAGTGGATCCCGCACCGGGG + Intronic
941820866 2:169841957-169841979 ACCTAGTGGATCCCGCACCGGGG - Intronic
942368583 2:175256938-175256960 GCCTAGTGGATCCCGCGCTGGGG + Intergenic
942620085 2:177836095-177836117 ACCTAGTGGATCCCGCACTGGGG - Intronic
943365360 2:186962656-186962678 ACCTAATGGATCCCCCGCTAGGG - Intergenic
943835229 2:192508392-192508414 ACCTAGTGGATCCCGCACTGGGG - Intergenic
943941378 2:194002694-194002716 ACCCAGTGGATCCCGCTTTGGGG + Intergenic
943942799 2:194020584-194020606 ACCCTGTGGATCCCACACTGGGG - Intergenic
944058416 2:195547288-195547310 ACCCAGTGGATCTCACACTGGGG + Intergenic
945451420 2:210000553-210000575 ACCCAGTGGATCCCATACTGGGG + Intergenic
945664147 2:212721006-212721028 CCCTAGTGGATCCTGCGCTGGGG + Intergenic
945869224 2:215208297-215208319 GCCTAGTGGATCCCACGCCAGGG - Intergenic
945870292 2:215219486-215219508 ACCCAGTGGATCTCACACTGGGG - Intergenic
946054068 2:216885647-216885669 ACCCAGTGGATACCACACTGGGG - Intergenic
946376574 2:219313200-219313222 ACCCAGTGGATCCCACACCGGGG - Intergenic
946982089 2:225229385-225229407 ACCCAGTGGATCCCGCATCGGGG + Intergenic
948449036 2:238057790-238057812 ACCCAGTGGATCCCCCACTGCGG + Intronic
1169126106 20:3127960-3127982 TCCTAGTGCTTCCCACTTTGAGG + Intronic
1169814381 20:9641526-9641548 ACCTAGTGGATCCCGCACCGGGG + Intronic
1170166465 20:13364665-13364687 ACCAAGTTGATACCAAGTTGGGG - Intergenic
1170230810 20:14044765-14044787 ACCCAGTGGATCCCGCACTGGGG + Intronic
1170369545 20:15634023-15634045 ACCTAGTGGATACTAAGGTGGGG - Intronic
1170806772 20:19639565-19639587 ACCCAGTGGATCCCGCACTGGGG + Intronic
1171318775 20:24220658-24220680 ACGTAGTGGATCCCACACCGGGG + Intergenic
1172431776 20:34898738-34898760 ACCCAGTGGATCCCGCACTGGGG + Intronic
1173195455 20:40910406-40910428 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1173195763 20:40911607-40911629 ACCTAGTGGATCCCGCACTGGGG - Intergenic
1174162817 20:48564046-48564068 ACCCAGTGGATCCCATACTGGGG + Intergenic
1176671114 21:9735960-9735982 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1177497007 21:21902848-21902870 ACCTAGTGGATCCCACACGGGGG - Intergenic
1177549176 21:22598218-22598240 GCCTAGTGGATCCTGCGCTGGGG - Intergenic
1177565755 21:22818795-22818817 ACCCAGTGGATCCCACACCGGGG + Intergenic
1177637693 21:23807439-23807461 ACCCAGTGGATCCCACACTGGGG - Intergenic
1178054604 21:28784181-28784203 ACCTAGTGGATCCTACACCGGGG - Intergenic
1178398819 21:32265755-32265777 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1178585572 21:33868254-33868276 ACCCAGTGGATCCCACACCGGGG + Intronic
1178983279 21:37283122-37283144 ACCCAGTGGATCCCACACCGGGG + Intergenic
1181450467 22:23016989-23017011 ACCCAGTGGATCCCGCGCCGGGG + Intergenic
1183685312 22:39358023-39358045 ACCTAGTGGATCCCGCACCGGGG - Intronic
949292832 3:2485336-2485358 ACCTAGTGGATCCTGCACTGGGG - Intronic
950204774 3:11071156-11071178 GCCTAGTGGATCCCACGTAAGGG + Intergenic
950256583 3:11511533-11511555 ACCTAGTGGATCCTGCACTGGGG + Intronic
950513293 3:13447133-13447155 ACCTAGTGGATCCCGCACTGGGG + Intergenic
951129930 3:19030090-19030112 ACCTAGTGGATTCCCAGCTGTGG + Intergenic
952355455 3:32579138-32579160 ACCCAGTGGATCCCCCACTGGGG - Intergenic
952398306 3:32940106-32940128 ACCCAGTGGATCCCGCACTGGGG - Intergenic
952593718 3:34988801-34988823 ACCCAGTGGATCCCCCACTGGGG - Intergenic
953089906 3:39713739-39713761 ACCTAGTGGATCCCGCACCGGGG - Intergenic
953342127 3:42143492-42143514 ACCTAATGGCTCCCTCATTGTGG - Intronic
953714695 3:45307111-45307133 ACCCAGTGGATCCCACACTGGGG - Intergenic
954041075 3:47887632-47887654 ACCTAGTGGATCTCGCACTGGGG - Intronic
954089255 3:48271877-48271899 CCCTAGTGGATCCCGCACTGGGG + Intronic
954226128 3:49182601-49182623 ACCCAGTGGATCCCGCACTGGGG + Intronic
954230510 3:49213474-49213496 ACCTAGTGGATCCTGCACTGGGG + Intronic
955183432 3:56692304-56692326 ACCCAGTGGATCCCGCACTGGGG - Intergenic
955210361 3:56934889-56934911 ACCTAGTGGATCCCGCAGCGGGG - Intronic
955266384 3:57449282-57449304 ACCTAGTGGATCCCACACCCGGG + Intronic
955449554 3:59051281-59051303 ACCTAGTGGATCCCGCACTGGGG - Intergenic
956438896 3:69260676-69260698 GCCTAGTGGATCCCGTGCTGGGG - Intronic
956459303 3:69454852-69454874 CCCTAGTGGATCCCACGCAGGGG - Intronic
956481529 3:69677869-69677891 ACCTAGTGGATCCCGCACCGGGG - Intergenic
956855336 3:73269616-73269638 ACCTAGTGGATCCCGCACCGGGG - Intergenic
957009108 3:74985062-74985084 ACCCAGTGGATCCCACACCGGGG + Intergenic
957056094 3:75444371-75444393 ACCAAGTGGATCCCACACGGGGG + Intergenic
957362160 3:79173746-79173768 ACCCAGTGGATCCCGCACTGGGG - Intronic
957419585 3:79951307-79951329 ACCCAGTGGATCCCGCATGGGGG + Intergenic
957446194 3:80314872-80314894 ACCCAGTGGATCCCACACTGGGG - Intergenic
957556220 3:81767313-81767335 ACCCAGTGGATCCCGCACTGGGG + Intergenic
957921899 3:86758023-86758045 ACCCAGTGGATCCCGCACTGGGG - Intergenic
957995182 3:87679522-87679544 ACCTAGTGGATCCCACACGCGGG - Intergenic
960479608 3:118171773-118171795 GCCTAGTGGATCCCTTGCTGGGG - Intergenic
960685563 3:120290093-120290115 ACCCAGTGGATCCCACACTGGGG - Intergenic
961268878 3:125672165-125672187 ACCTAGTGGATCCCCCACAGCGG - Intergenic
961460538 3:127047101-127047123 ACCTAGTGGATCCCGCACCGGGG - Intergenic
961464977 3:127076221-127076243 ACCCAGTGGATCCCACACCGGGG + Intergenic
962283674 3:134070197-134070219 ACCTAGTGGATCCCACACCGGGG + Intronic
962398678 3:135039363-135039385 ACCTAGTGGATCCCGCACTGGGG + Intronic
963673434 3:148280502-148280524 ACCCAGTGGATCCCGCACTGGGG + Intergenic
964138276 3:153369688-153369710 CCCTAGTGGATCCCGTGCTGGGG + Intergenic
964139148 3:153378272-153378294 ACCTAGTGGATCCCGCACTGGGG + Intergenic
964851063 3:161096800-161096822 ACCCAGTGGTTCTCACTTTGCGG + Intronic
964993437 3:162844552-162844574 ACCTAGTGGATCCTGCACTGGGG + Intergenic
965040374 3:163499448-163499470 ACCCAGTGGATCTCACACTGGGG - Intergenic
965078073 3:164003392-164003414 ACCCAGTGGATCCCGCACTGGGG - Intergenic
965200269 3:165649253-165649275 ACCCAGTGGATCCCGCACTGCGG + Intergenic
965753154 3:171998807-171998829 ACCTAGCGGATCCCACACTGGGG + Intergenic
966096708 3:176213352-176213374 ACCCAGTGGATCCCGCACTGGGG + Intergenic
966182959 3:177203811-177203833 ACCTAGTGGATCCAGTGCTGGGG + Intergenic
966725079 3:183101324-183101346 ACCTAGTGGATCCCGCACCGGGG - Intronic
967594840 3:191316949-191316971 GCCTAGCGGATCCCACGCCGGGG + Intronic
968412735 4:403936-403958 ACCCAGTGGATCCCGCGCCGGGG + Intergenic
968469746 4:773952-773974 ACCCAGTGGATCCTGCGCTGGGG - Intergenic
969815000 4:9680264-9680286 ACCAAGTGGATCCCACATGGGGG - Intergenic
970391292 4:15615338-15615360 ACCCAGTGGATCCCACACCGGGG - Intronic
971280455 4:25239178-25239200 ACCCAGTGGATCCCACACTGGGG + Intronic
971281605 4:25246560-25246582 ACCCAGTGGATCCCACACTGGGG + Intronic
971377033 4:26063906-26063928 ACCCAGTGGATCCCGCACTGGGG + Intergenic
971552964 4:27978271-27978293 ACCTAGTGGATCCCACACTGGGG + Intergenic
971618854 4:28828431-28828453 ACCTAGTGGATCCTGCACTGGGG - Intergenic
971639899 4:29117778-29117800 ACCCAGTGGATCCCGCACTGGGG - Intergenic
971709536 4:30093131-30093153 ACCCAGTGGATCCCGCTCTGGGG - Intergenic
971792274 4:31184905-31184927 ACCTAGTGGATCCCGCTCCGGGG + Intergenic
972173455 4:36375395-36375417 ACCTAGTGGATCCCACACTGGGG - Intergenic
972913388 4:43846600-43846622 ACCTAGTGGATCCCGTGCTGGGG - Intergenic
973146401 4:46831472-46831494 ACCCAGTGGATCCCGCACTGGGG - Intronic
973322838 4:48827806-48827828 ACCTAGTGGATCCCATGCCGGGG - Intronic
973817662 4:54632960-54632982 ACCCAGTGGATCCCGCACTGGGG - Intergenic
974147496 4:57965849-57965871 ACCCAGTGGATCCCGCACTGGGG - Intergenic
974186865 4:58457353-58457375 GCCTAGTGGATCCCCCACTGGGG - Intergenic
974641670 4:64640409-64640431 ACCTAGTGGATCCCGCATGGGGG + Intergenic
974792691 4:66712354-66712376 ACCCAGTGGATCCCGCACTGGGG + Intergenic
974839263 4:67282760-67282782 GCCTAGTGGATCCCATGCTGGGG + Intergenic
974892220 4:67896501-67896523 ACCCAGTGGCTCCCCCATTGGGG + Intergenic
974992796 4:69115176-69115198 ACCCAGTGGATCCCACACTGGGG + Intronic
975055476 4:69924315-69924337 ACCCAGTGGATCCCACACTGGGG - Intergenic
975308624 4:72877503-72877525 ACCCAGTGGATCCCATACTGGGG - Intergenic
975755943 4:77571087-77571109 ACCCAGTGGATCCCACACCGGGG - Intronic
976102566 4:81580875-81580897 ACCTAGTGGATCCCACACCGGGG - Intronic
976646795 4:87395882-87395904 ACCTAGTGGATCCCGCACAGGGG + Intergenic
976736228 4:88313139-88313161 ACCCAGTGGATCCCGCACTGGGG + Intergenic
976980220 4:91217906-91217928 ACCTAGTGGATCCCGCACCGGGG + Intronic
977206602 4:94170268-94170290 ACCTAGTGGATCCCCTACTGGGG - Intergenic
977750887 4:100608701-100608723 ACCTAGTGGATCCCGCACCGGGG + Intronic
977883672 4:102234763-102234785 GCCTAGTGGATCCCATGCAGGGG - Intergenic
978207119 4:106092335-106092357 ACCCAGTGGATCCCACACTGGGG + Intronic
978241808 4:106525280-106525302 ACCCAGTGGATCCCTCACTGGGG + Intergenic
978748647 4:112222856-112222878 ACCTAGTGGATCCCATGCTGGGG - Intergenic
978999502 4:115200130-115200152 ACCCAGTGGATCCCGCACTGGGG + Intergenic
979424677 4:120550673-120550695 ACCTAGTGGATCCCGCACTGGGG + Intergenic
979445609 4:120808547-120808569 ACCCAGTGGATCCTACACTGGGG + Intronic
979822624 4:125192326-125192348 ACCTAGTGGATCCCTCACAGGGG - Intergenic
979825628 4:125229518-125229540 ACCCAGTGGATCCCGCACTGGGG + Intergenic
979857436 4:125651699-125651721 ACCCAGTGGATCCCACACCGGGG + Intergenic
980470151 4:133240343-133240365 ACCTAGTGGATCCCACACCGGGG + Intergenic
980739336 4:136929419-136929441 ACCCAGTGGATCCCACACCGGGG - Intergenic
980799838 4:137734160-137734182 ACCTAGTGGATCCCGCACTGGGG - Intergenic
981136275 4:141213971-141213993 CCCTAGTGGATCCCACGCTGGGG - Intergenic
981176513 4:141689794-141689816 ACCCAGTGGATCCCACACTGGGG + Intronic
981280677 4:142954685-142954707 GCCTAGTGGATCCTGCGCTGGGG - Intergenic
982408303 4:155044727-155044749 ACCTAGTGGATCCCACACCAGGG - Intergenic
982758413 4:159251348-159251370 GCCTAGTGGATCCCACGCCTGGG - Intronic
983552981 4:169035772-169035794 ACCTAGTGGATCCCACATCCGGG + Intergenic
984728726 4:183045490-183045512 ACCTAGTGGATCCTGCACTGGGG - Intergenic
984918182 4:184741628-184741650 ACCTAGTGGATCCCACACCAGGG - Intergenic
985195038 4:187420558-187420580 ACCTAGTGGATCCCACACTGGGG + Intergenic
985590961 5:764781-764803 ACCTAGTGGCTCCCACACCGGGG - Intronic
986121220 5:4837958-4837980 ACCCAGTGGATCCCACACCGGGG - Intergenic
986963664 5:13244610-13244632 ACCTAGTGGATCCCACGCTGGGG - Intergenic
987146173 5:14993740-14993762 ACCCAGTGGATCCCACACCGGGG + Intergenic
987347365 5:16990917-16990939 ACCCAGTGGATCCCGCACTGGGG + Intergenic
987877024 5:23691549-23691571 ACCTAGTGGATCCCGCACTGGGG - Intergenic
987990173 5:25199958-25199980 ACCCAGTGGATCCCACAGAGGGG + Intergenic
988035500 5:25823253-25823275 ACCTAGTGGATCCCATGCCAGGG + Intergenic
988086910 5:26485216-26485238 ACCCAGTGGATCCCGCATGGGGG + Intergenic
988132237 5:27120324-27120346 ACCTAGTGGATCCCACACCGGGG - Intronic
988142993 5:27267188-27267210 ACCTAGTGGATCCCCAGCCGGGG + Intergenic
988201700 5:28077604-28077626 ACCCAGTGGATCCCACACGGTGG + Intergenic
988279485 5:29127559-29127581 ACCCAGTGGATTCCGCATTGGGG + Intergenic
988500224 5:31777542-31777564 ATCTAGTGGATCCCGCGTGGGGG - Intronic
988684660 5:33515324-33515346 ACCCAGTGGATCCCACACAGGGG + Intergenic
988915822 5:35892803-35892825 ACCTAGTGGATCCCGCACTGGGG + Intergenic
989003280 5:36783005-36783027 ACCCAGTGGATCCCACACCGGGG - Intergenic
989346871 5:40439084-40439106 ACCTAGTGGATCCCGCACCGGGG - Intergenic
989950648 5:50293272-50293294 ACCTAGTGGATCCCACACCCCGG - Intergenic
990665641 5:58069075-58069097 ACCTAGTGGATCCCACACCGGGG + Intergenic
992048945 5:72925912-72925934 GCCTAGTGGATCCCACGCCGGGG - Intergenic
992050438 5:72935668-72935690 GCCTAGTGGATCCCACGCTGGGG - Intergenic
993031951 5:82715114-82715136 ACCCAGTGGATCCCGCACTGGGG - Intergenic
993320857 5:86466617-86466639 ACCTAGTGGATCCCACACCGGGG + Intergenic
993803463 5:92374829-92374851 ACCCAGTGGATTCCACACTGGGG + Intergenic
993822118 5:92631756-92631778 ACCCAGTGGATCCCACACTGGGG - Intergenic
993995305 5:94715398-94715420 ACATAGTGGATTCCAGGTTTTGG - Intronic
994605529 5:101962381-101962403 ACCTAGTGGATCCCGCACAGGGG + Intergenic
994734916 5:103540619-103540641 CCCTTGTGGATCCCACATTTTGG - Intergenic
995679794 5:114704224-114704246 ACCTAGTGGATCCCGCACTGGGG + Intergenic
995700475 5:114929332-114929354 ACCTAGAGGATCCCACACCGGGG - Intergenic
996478623 5:123949125-123949147 ACCTAGTGGATCCCGCACTGGGG + Intergenic
996575815 5:124976054-124976076 ACCTAGTGGATCCCACACTGGGG + Intergenic
999406261 5:151309617-151309639 ACCCAGTGGATCCCACACCGGGG - Intergenic
1000066112 5:157694263-157694285 ACCCAGTGGATGCCACACTGGGG - Intergenic
1000084823 5:157879702-157879724 GCCTAGTGGATCCCACACCGAGG - Intergenic
1000085946 5:157887268-157887290 ACCTAGTGGATCCCGCGCTGGGG - Intergenic
1000547689 5:162622269-162622291 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1001756061 5:174171010-174171032 TCCTAGTGGACCCAGCGTTGGGG + Intronic
1002221817 5:177688659-177688681 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1002758096 6:180031-180053 GCCTAGTGGATCCTGCGCTGGGG - Intergenic
1002793276 6:450393-450415 ACCCAGTGGATCTCACACTGGGG - Intergenic
1003060803 6:2860565-2860587 ACCCAGTGGACCCCACACTGGGG - Intergenic
1003069750 6:2936243-2936265 ACCTAGTGGATCTCGCACTGGGG - Intergenic
1003170776 6:3720701-3720723 ACCTAGTGGATCCCACACTGGGG + Intergenic
1003578245 6:7316759-7316781 ACCCAGTGGATCCCACACCGGGG + Intronic
1003589672 6:7426162-7426184 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1003717780 6:8666393-8666415 ACCCAGTGGATCCCACACCGGGG - Intergenic
1003736973 6:8887590-8887612 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1003901670 6:10660314-10660336 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1004045290 6:12017867-12017889 ACCCAGTGGATCCCGCACTGGGG + Intronic
1004861311 6:19806946-19806968 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1005035494 6:21552218-21552240 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1005332803 6:24765871-24765893 ACCTAGTGGATCCCGCGCCGGGG + Intergenic
1005561507 6:27045658-27045680 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1005600789 6:27424763-27424785 ACCCAGTGGACCCCGCGCTGGGG + Intergenic
1005707373 6:28469289-28469311 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1005749848 6:28872527-28872549 ACCTAGTGGATTCCGCACTGGGG + Intergenic
1005751226 6:28885070-28885092 GCCTAGTGGATCCCGCACTGGGG + Intergenic
1005976931 6:30807377-30807399 ACCTAGTGGACCCCACACTGGGG + Intergenic
1006128029 6:31852440-31852462 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1006352720 6:33532815-33532837 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1006477909 6:34269451-34269473 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1006505434 6:34485978-34486000 ACCCAGTGCCGCCCACGTTGCGG - Intronic
1006696086 6:35931695-35931717 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1008254145 6:49275868-49275890 ACCCAGTGGATCCCACACCGGGG - Intergenic
1008270109 6:49481762-49481784 ACCCAGTGGAGCCCACACTGGGG + Intronic
1008270418 6:49483357-49483379 ACCCAGTGGATCCCACACTGGGG + Intronic
1008437820 6:51496799-51496821 ACCTAGTGAAGCCCACTTGGTGG + Intergenic
1008567902 6:52786909-52786931 ACCCAGTGGATCCCACACCGGGG - Intergenic
1009510734 6:64547661-64547683 ACCCAGTGGATCCCATACTGGGG + Intronic
1009587723 6:65627966-65627988 ACCTAGTGGATCCCGCACCGGGG - Intronic
1009739354 6:67723476-67723498 ACCTAGTGGATCCCACACCAGGG - Intergenic
1010235564 6:73572467-73572489 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1010617461 6:78030227-78030249 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1011129249 6:84037414-84037436 GCCTAGTGGATCCCACGCCAGGG + Intronic
1011143768 6:84189793-84189815 ACCTAGTGGATCCCGCACCGGGG - Intronic
1011178188 6:84587816-84587838 ACCCAGTGGATCCCGCATTGGGG - Intergenic
1012131370 6:95497367-95497389 GCCTAGTGGATCCCGCGCCGGGG - Intergenic
1012189264 6:96260881-96260903 ACCCAGTGGATCCCACACAGGGG + Intergenic
1012598414 6:101066606-101066628 ACCTAGTGGATCCCACGCCAGGG + Intergenic
1012733483 6:102910655-102910677 ACCCAGTGGATCCCACACTGGGG + Intergenic
1013143490 6:107364180-107364202 ACCTAGTGGATCCCGCACTGGGG + Intronic
1013686482 6:112590645-112590667 CTCTAGAGGATTCCACGTTGGGG - Intergenic
1014240820 6:119015749-119015771 ACCTAGTGGATCCCGCACCGGGG - Intronic
1014499203 6:122165063-122165085 ACCCAGTGGATCCCACACCGGGG + Intergenic
1014739081 6:125126279-125126301 ACCCAGTGGATCCCGCACTGGGG - Intronic
1015958472 6:138622509-138622531 ACCTTTTGGTTCCCACGTGGGGG + Intronic
1016069818 6:139726271-139726293 ACCTAGTGGATCCCTCACCGGGG + Intergenic
1016172863 6:141041559-141041581 ACCTAGTGGATCCCGCACAGGGG + Intergenic
1017299057 6:152834769-152834791 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1018064158 6:160114452-160114474 ACCCAGTGGATCCCACACCGGGG + Intergenic
1019000187 6:168743719-168743741 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1019086303 6:169480465-169480487 GCCTAGTGGATCCCGCTCTGGGG - Intronic
1020163991 7:5793918-5793940 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1020784355 7:12556097-12556119 ACCCAGTGGATCCCACACTGGGG + Intergenic
1021133949 7:16943411-16943433 ACCTAGTGGATCCCGCACTGGGG - Intergenic
1021148540 7:17120245-17120267 ACCGAGTTGATCCCACCTTGAGG + Intergenic
1021359330 7:19692186-19692208 ACCTAGTGGATCCCACACAGGGG + Intergenic
1021520636 7:21536524-21536546 ACCCAGTGGATCCCACACCGGGG + Intergenic
1021567817 7:22032302-22032324 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1024256842 7:47545793-47545815 CCCTAGGGGATCCCACCTGGGGG + Intronic
1024465983 7:49711682-49711704 ACCCAGTGGATCCCACACTGGGG - Intergenic
1024834124 7:53495446-53495468 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1026187017 7:68090349-68090371 ACCTAGTGGATCCCACAACGGGG + Intergenic
1026516645 7:71078412-71078434 ACCCAGTGGATCCCACACCGGGG - Intergenic
1026596482 7:71738014-71738036 ACCTAGTGGATCCCACACCAGGG + Intergenic
1027665968 7:81043133-81043155 ACCTAGTGGATCCTGCACTGGGG - Intergenic
1027698206 7:81437025-81437047 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1027779026 7:82499995-82500017 ACCCAGTGGATCCCACACTGGGG - Intergenic
1027868175 7:83673736-83673758 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1028303224 7:89228704-89228726 ACCCAGTGGATCCCACACCGGGG + Intronic
1028719347 7:94011807-94011829 ACCTAGTGGATCCTGCAGTGGGG + Intergenic
1028727241 7:94101260-94101282 GCCTAGTGGATCCCGCACTGGGG - Intergenic
1028852440 7:95552401-95552423 ACCCAGTGGATCCCACACCGGGG + Intergenic
1028857238 7:95605688-95605710 ACCTAGTGGATCCCACATGGGGG - Intergenic
1028913069 7:96229133-96229155 ACCTAGTAGATCCCGCACTGGGG - Intronic
1029037972 7:97541548-97541570 ACCTAGTGGATCCCACGCCAGGG - Intergenic
1029832302 7:103274860-103274882 ACCTAGTGGATCCTGCACTGGGG + Intergenic
1030215654 7:107042297-107042319 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1030292726 7:107888243-107888265 ACCCAGTGGATCCTGCGCTGGGG - Intergenic
1030980617 7:116181918-116181940 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1031056461 7:116997932-116997954 ACCTAGTGGATCCCGCACTGGGG + Intronic
1031110040 7:117596534-117596556 ACCCAGTGGATCCCGCACTGGGG - Intronic
1031292185 7:119951446-119951468 ACCTAGTGGATCCCACACTGGGG + Intergenic
1031409286 7:121422152-121422174 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1032248145 7:130230447-130230469 ACCTAGTGGATCCCGCACAGGGG - Intergenic
1032339724 7:131059186-131059208 ACTTAGTGGATCCCACACTGGGG - Intergenic
1033394020 7:140956890-140956912 ACCTAGTGGATCCTGCACTGGGG + Intergenic
1033779397 7:144650849-144650871 ACCTAGTGGATCCCGCACCGGGG - Intronic
1034091122 7:148364233-148364255 ACCTAGTGGATCCCGCACTGGGG - Intronic
1034097991 7:148426833-148426855 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1034155094 7:148949506-148949528 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1034167681 7:149038634-149038656 ACCTAGTGGATCCCACACCGGGG + Intergenic
1034900927 7:154907325-154907347 GCCTAGTGGATCCCGTGCTGGGG - Intergenic
1035683497 8:1507104-1507126 ACCTAGCGGATCCTGCGCTGGGG + Intronic
1036123751 8:6044996-6045018 ACCCAGTGGATCCCACACGGAGG + Intergenic
1037239429 8:16760476-16760498 ACCTAGTGGATCCCACACCAGGG + Intergenic
1037241628 8:16784331-16784353 ACCTAGTGGATCCCACACCGGGG - Intergenic
1037971264 8:23173734-23173756 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1039284928 8:36029251-36029273 ACCTAGTGGATCCTGCACTGGGG - Intergenic
1040003617 8:42599992-42600014 GCCTAGTGGATCCCACGCCAGGG + Intergenic
1040701862 8:50075279-50075301 GCCTAGTGGATCCCACCCAGGGG - Intronic
1040794239 8:51271659-51271681 ACCTAGTGGATCCTGCACTGGGG - Intergenic
1040954845 8:52969769-52969791 ACCCAGTGGATCTCACACTGGGG + Intergenic
1040964511 8:53071080-53071102 ACCTAGTGGATCCTGTGCTGGGG + Intergenic
1041068610 8:54104620-54104642 ACCTAGTGGATCCTGCACTGGGG - Intergenic
1042677073 8:71332976-71332998 ACCTAGTGGAGACCAGGTTGGGG - Intronic
1042948679 8:74179467-74179489 ACCTAGTGGATCCCGCACAGGGG + Intergenic
1043709959 8:83403371-83403393 ACCTAGTGGATCCCACACCGGGG - Intergenic
1043731875 8:83693933-83693955 ACCCAGTGGATCCCATACTGGGG + Intergenic
1043849390 8:85198757-85198779 AACTAGTGGATTCCATCTTGTGG + Intronic
1044633398 8:94300269-94300291 ACCCAGTGGATCCCACACCGGGG + Intergenic
1045131870 8:99163335-99163357 ACCTAGTGGATCCCGCACCGGGG + Intronic
1045743275 8:105387268-105387290 ACCCAGTGGATCCCGCATTGGGG + Intronic
1046521320 8:115330502-115330524 GCCTAGTGGATCCCACACAGGGG + Intergenic
1046540019 8:115567778-115567800 ACATAGTGGATTGCACGTTAGGG - Intronic
1046871479 8:119209041-119209063 ACCTGGTGGCTGCCACGCTGTGG + Intronic
1047124835 8:121948501-121948523 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1048575966 8:135690393-135690415 ACCCAGTGGATTCCACACTGGGG + Intergenic
1048655342 8:136530388-136530410 ACCCAGTGGATCCTACACTGAGG + Intergenic
1049087560 8:140490452-140490474 ACCCAGTGGATCCCACACTGGGG + Intergenic
1049944437 9:580707-580729 ACCTAGTGGATCCCGCACTGGGG + Intronic
1050294991 9:4195700-4195722 GCCTAGTGGATCCCGCGCTGTGG - Intronic
1050920688 9:11197290-11197312 ACCTAGTGGATCCTGCACTGGGG - Intergenic
1052056604 9:23914395-23914417 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1052576649 9:30299688-30299710 ACCTAGTGGATCCCACACTGGGG - Intergenic
1052985275 9:34482700-34482722 ACCTAGTGGATCCCCCACCGGGG + Intronic
1053547839 9:39042293-39042315 ACCTAGTGGATCCCGCACAGGGG + Intergenic
1053811963 9:41862334-41862356 ACCTAGTGGATCCCACACCGGGG + Intergenic
1053928354 9:43089787-43089809 GCCTAGCGGATCCCGCGCTGGGG - Intergenic
1054618632 9:67325105-67325127 ACCTAGTGGATCCCACACCGGGG - Intergenic
1055461387 9:76523664-76523686 ACCCAGTGGATCCCACACAGGGG + Intergenic
1055557509 9:77490320-77490342 ACCTAGTGGATCCCACACTGGGG + Intronic
1055651447 9:78410419-78410441 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1056771320 9:89480354-89480376 ACCTAGTGGATCCCGCACCGGGG + Intronic
1057383850 9:94591080-94591102 ACCTAGTGGATCCCGCACCGGGG + Intronic
1057628556 9:96700824-96700846 ACCTAGTGGATCCCACACCGGGG + Intergenic
1057764240 9:97902112-97902134 ACAGAGTGGATCTCACGTTCAGG + Intergenic
1058309569 9:103484100-103484122 ACCTAGTGGATCCCCTGCAGGGG - Intergenic
1058365251 9:104201018-104201040 ACCTGGTGGATCCTGCATTGGGG - Intergenic
1059810689 9:117852409-117852431 ACCCAGTGGATCCCACACCGGGG - Intergenic
1059991489 9:119870218-119870240 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1060329452 9:122652965-122652987 TCCAGGTGGATCCCACATTGTGG - Intergenic
1062146135 9:134990968-134990990 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1186282019 X:8003253-8003275 ACCTAGTGGATCCCACACTGGGG + Intergenic
1186854038 X:13608940-13608962 AACAAGTGGATCCAGCGTTGAGG - Intronic
1187139127 X:16575876-16575898 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1187304677 X:18084227-18084249 ACCTAGTGGATCCCACACTGGGG - Intergenic
1187557503 X:20366786-20366808 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1188166890 X:26873637-26873659 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1188189599 X:27157427-27157449 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1188242750 X:27809715-27809737 ACCCAGTGGATCCCGCACTGGGG - Intronic
1191618568 X:63192509-63192531 ACCCAGTGGATCCCGCATCGGGG + Intergenic
1192186826 X:68952538-68952560 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1192251483 X:69417186-69417208 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1192670950 X:73140660-73140682 CACTTGTGGATCCCAGGTTGAGG + Intergenic
1192869593 X:75173534-75173556 ACCTAGTGGATCCTACACCGGGG + Intergenic
1193040136 X:76996595-76996617 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1193538087 X:82738140-82738162 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1193951696 X:87808632-87808654 ACCTAGTGGATCCCACACCTGGG + Intergenic
1194071531 X:89330966-89330988 ACCTAGTGGATCCCACACTGGGG + Intergenic
1194166416 X:90521759-90521781 ACCTAGTGGATCCCGCACTGGGG - Intergenic
1194197618 X:90914892-90914914 ACCTAGTGGATCCCTTGCTGGGG + Intergenic
1194204547 X:90995826-90995848 ACCTAATGGATCCCACACAGGGG - Intergenic
1194384456 X:93236161-93236183 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1194650749 X:96512188-96512210 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1195257964 X:103107285-103107307 ACCCAGTGGATCCCACACTGGGG + Intergenic
1195896294 X:109749271-109749293 ACCCAGTGGATCCCTCACTGGGG + Intergenic
1196662459 X:118282678-118282700 ACCTAGTGGATCCCGCACAGGGG + Intergenic
1196705836 X:118716873-118716895 ACCCAGTGGATCCCGCACTGGGG + Intergenic
1196741584 X:119029939-119029961 ACCTAGTGGATCCTACACCGGGG - Intergenic
1196793912 X:119487800-119487822 ACCTAGTGGATCCCACACTGGGG + Intergenic
1196827198 X:119750758-119750780 ACCTAGTGGATCCCGCACTGGGG + Intergenic
1197978826 X:132194509-132194531 ACCTAGTGGATCCCCCACAGGGG - Intergenic
1198060985 X:133044803-133044825 ACTCAGTGGATCCCACACTGGGG - Intronic
1199009867 X:142745660-142745682 ACCTAGTGGATCCCGCAGCGGGG + Intergenic
1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG + Intergenic
1199175611 X:144784042-144784064 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1200423492 Y:2998312-2998334 ACCTAGTGGATCCCGCACCGGGG + Intergenic
1200725769 Y:6666695-6666717 ACCTAGTGGATCCCACACTGGGG + Intergenic
1200824223 Y:7622153-7622175 ACCTAGTGGATCCCACACCGGGG + Intergenic
1201468405 Y:14309667-14309689 ACCCAGTGGATCCCACACTGGGG - Intergenic
1201469169 Y:14314874-14314896 ACCCAGTGGATCCCGCACTGGGG - Intergenic
1201480006 Y:14428514-14428536 ACCTAGTGGATCCCGCACCGGGG - Intergenic
1201495625 Y:14589720-14589742 ACCTAGTGGATCCCACACCGAGG + Intronic
1201496868 Y:14598134-14598156 ACCTAGTGGATCCCGCACTGGGG + Intronic
1201499502 Y:14627249-14627271 ACCTAGTGGATCCCGCGCTGGGG + Intronic
1202235831 Y:22708934-22708956 ACCTAGTGGATCCCACACCGGGG - Intergenic
1202307332 Y:23487234-23487256 ACCTAGTGGATCCCACACCGGGG + Intergenic
1202563473 Y:26183352-26183374 ACCTAGTGGATCCCACACCGGGG - Intergenic