ID: 1099415149

View in Genome Browser
Species Human (GRCh38)
Location 12:82375324-82375346
Sequence CTGCATGTGAAGATGTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099415144_1099415149 14 Left 1099415144 12:82375287-82375309 CCGTATAAAAGAGGTACAAGGAA 0: 1
1: 6
2: 35
3: 179
4: 818
Right 1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG 0: 1
1: 0
2: 1
3: 25
4: 237
1099415143_1099415149 15 Left 1099415143 12:82375286-82375308 CCCGTATAAAAGAGGTACAAGGA 0: 1
1: 0
2: 3
3: 40
4: 279
Right 1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG 0: 1
1: 0
2: 1
3: 25
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099415149 Original CRISPR CTGCATGTGAAGATGTAGCA AGG Intronic
901107484 1:6768426-6768448 CAGCTTGTGAAGATGCAGCCAGG + Intergenic
901718822 1:11178629-11178651 CTGGATGTGAAGAAGCAGAAAGG - Intronic
902408392 1:16198981-16199003 CTGCTTGTAAAGATATAGGATGG - Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906834373 1:49067249-49067271 AAGCATGGGAAGATGGAGCAAGG + Intronic
906895260 1:49763930-49763952 TTGCATGACAAGAAGTAGCAGGG - Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
912695640 1:111840076-111840098 CACCATGTGAGGATGCAGCAAGG - Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
915353595 1:155241872-155241894 CTGCATCTGATGATGAAACAAGG - Intronic
915841067 1:159213459-159213481 CTGAATGAGAAGAAGTAACAGGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916584385 1:166137857-166137879 CTGCATGTGGGGATGTAGACAGG - Intronic
917680404 1:177360398-177360420 CTGGATGTAAAGATGTGGCTTGG + Intergenic
917837345 1:178951966-178951988 CTGCATGTGAGCGTGGAGCAGGG + Intergenic
918080711 1:181205982-181206004 CTGCTTGTGAACTTGCAGCACGG - Intergenic
918202534 1:182280500-182280522 CTGCATGTGAAATAGTAGCATGG + Intergenic
922982954 1:229843928-229843950 CTGCAAGGGAAGATGTTGCAGGG - Intergenic
923195698 1:231664593-231664615 CTGCTTTTGAAGATGGAGAAAGG + Intronic
923610102 1:235483797-235483819 GTGCATGTGAAGTAGCAGCATGG - Intronic
924077514 1:240355813-240355835 CAGCCTGTGAAGTTGAAGCAGGG + Exonic
1064720556 10:18224883-18224905 GTGCCTGTCAGGATGTAGCAGGG - Intronic
1065250947 10:23813037-23813059 CTGCTGGTGAACATGTAACATGG - Intronic
1065293707 10:24255478-24255500 CTTCATGTCCAGATGTGGCATGG - Intronic
1065794738 10:29295797-29295819 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1065947997 10:30624934-30624956 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1068144104 10:53044322-53044344 GTACATGTAAAGATGTTGCATGG + Intergenic
1070688261 10:78505941-78505963 CTGCTTGTGGGGATGTAGAATGG + Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071669247 10:87591999-87592021 TTGCTTGTGAGGTTGTAGCATGG + Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1074346513 10:112691353-112691375 TTGGATGGGAAGATGTAGCAAGG + Intronic
1075283895 10:121166195-121166217 CACCATGTGAGGATGCAGCAAGG + Intergenic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1076223752 10:128756935-128756957 CTGTGTGTGAAGATGTAGACTGG - Intergenic
1077021351 11:418471-418493 CTGCGTGAGAAGATGTGGCATGG - Exonic
1078010098 11:7566338-7566360 CTGCATGTGAATATGTATATGGG - Intronic
1078616131 11:12867885-12867907 TTGCCTGGGAAGATGTAGGAAGG + Intronic
1079320208 11:19445627-19445649 CAGAATGTCAAGATGTAGCTAGG + Intronic
1080526650 11:33128963-33128985 CTGCATGGGAAGATGGGGGATGG - Intronic
1080686428 11:34519218-34519240 AAGGATGTGAAGATGGAGCATGG + Intergenic
1081293975 11:41362814-41362836 CTGGCTGTGAAGATGAAGGAAGG - Intronic
1082256119 11:50035334-50035356 CTGCATTTCAAAATCTAGCATGG + Intergenic
1083504719 11:63145350-63145372 CTGCATCTTAAGATGTTTCACGG - Intronic
1088070280 11:105775143-105775165 AGGCATGTGAAGATGGAGCTGGG - Intronic
1088135295 11:106549782-106549804 CAGCATGGGAGAATGTAGCAGGG - Intergenic
1089822310 11:121239757-121239779 CTGAATGAGAAGATGCAACAAGG + Intergenic
1090448466 11:126785067-126785089 TTGCCTGTGAAGATGAAGTAGGG + Intronic
1090911263 11:131121632-131121654 CTACATGGGAAGATGAAGCTGGG + Intergenic
1093348754 12:18071065-18071087 CTGAATGCGAAGATGGAACAAGG + Intergenic
1093784586 12:23177389-23177411 CTGCATCTGAAGATGAGGCTGGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098215063 12:68207138-68207160 CTGCTGGTGTAGCTGTAGCAGGG + Intronic
1099199844 12:79662806-79662828 TGGCATGTGAAGATGGAGTAAGG + Intronic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1099420667 12:82455628-82455650 CTGCATGAGCAAATGTACCAAGG + Intronic
1100335267 12:93623277-93623299 CTGCAGGTGAAGGGGAAGCAAGG - Intergenic
1100347258 12:93744354-93744376 CTGCCTTTGAAGATGTAGATGGG - Intronic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102613612 12:114133952-114133974 CTGCATGTGAAGAAATAAGATGG + Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1107691775 13:42960775-42960797 CTGGCTTTGAAGATGTAGGAAGG - Intronic
1109253914 13:60054124-60054146 CAGCAGTTGAAGATGTTGCATGG - Intronic
1110255087 13:73424848-73424870 ATGAATGTTAAGATATAGCAAGG + Intergenic
1111286288 13:86096708-86096730 TTGCATGTCAAGCTGTAGCTGGG + Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1112927429 13:104693823-104693845 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1117363317 14:54999336-54999358 ATGCATGTGAAGATGGGGGAGGG + Intronic
1122562974 14:102630261-102630283 CAGCATGTGAAGAGGTCACATGG - Intronic
1122866777 14:104609449-104609471 CTGGCTTTGAAGATGGAGCAAGG - Intergenic
1123964358 15:25439541-25439563 CTGCCTTTGTAGATGTTGCAGGG + Intergenic
1123995477 15:25715367-25715389 CTGCAGGTGAAGATGTCTCTGGG - Intronic
1125587445 15:40830875-40830897 ATGCATGTAAACATTTAGCATGG + Intergenic
1126097539 15:45100169-45100191 CTGCAAGAGAAGATGCAGCGAGG - Exonic
1127374429 15:58370075-58370097 CTGCAGGTGAAGATGTATCCTGG + Intronic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1135661594 16:24301743-24301765 CTGCATGCGAAGATGAAGGAAGG - Intronic
1137770212 16:51010349-51010371 CTGAATGGAAAGATGTAGCCTGG + Intergenic
1138409092 16:56823668-56823690 CTGCATGTGACAATGCTGCAGGG - Intronic
1138965182 16:62075647-62075669 CCCCATGTGAAAATGCAGCAAGG - Intergenic
1139117981 16:63979933-63979955 CTACATATGAAGATGTTACACGG - Intergenic
1141372695 16:83502318-83502340 CTGGCTTTGAAGATGGAGCAAGG + Intronic
1141406037 16:83794013-83794035 CTGCCTCTGAAGATGAAGGAAGG + Intronic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1148583881 17:48762924-48762946 CTGCAAGTTAAGAGGTAGGAAGG + Exonic
1151656786 17:75499865-75499887 CTGAACCTGAAGATGGAGCAGGG + Exonic
1156585187 18:38424102-38424124 CAGCAAGTAAAGATGTAGAAAGG - Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157692480 18:49694866-49694888 CAGCATGAGAATATGTAGCAGGG - Intergenic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1165280739 19:34795056-34795078 TTCCATGTGAAGATGTCACAAGG - Intergenic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
925497235 2:4465750-4465772 CTGAATTTGAAGGTGTAGGAAGG + Intergenic
926613671 2:14973186-14973208 CTGCATGTGAAGATCAGGTATGG + Intergenic
926924587 2:17974453-17974475 TTGCCTGTGAAAATATAGCAAGG - Intronic
927844203 2:26463040-26463062 CTGGATGTGAGGATGACGCAGGG + Intronic
928764955 2:34635157-34635179 ATGCACGTGAAGATGAAGTAAGG + Intergenic
928824152 2:35398458-35398480 TTGAATGTGGAGATGTAGCCTGG + Intergenic
929978335 2:46656145-46656167 CTGGATGTGAAGAAGTCCCAAGG - Intergenic
930259593 2:49129603-49129625 CTGGAGCTGAAGATGTAGCATGG + Intronic
930771388 2:55133776-55133798 CTGCTTGTCAAGATGTCACAGGG + Intergenic
932784603 2:74589080-74589102 ATGCATGTGAAGTTTTAGCTTGG + Intronic
933539804 2:83625220-83625242 ATGCATGAAAAGATGTAGCCAGG + Intergenic
933940480 2:87240740-87240762 CTGGCTGTGAAGATGTGGGAAGG - Intergenic
934737679 2:96698243-96698265 CTCATTGTGAAGATGGAGCAGGG + Intergenic
934926675 2:98386768-98386790 CTGGCTTTGAAGATGTAGGAAGG + Intronic
935088416 2:99870510-99870532 CTGCATGGGTAGATCCAGCAGGG - Intronic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
935552553 2:104473769-104473791 CTCCATGAAAAGATGTATCAAGG + Intergenic
936352657 2:111725036-111725058 CTGGCTGTGAAGATGTGGGAAGG + Intergenic
936663419 2:114567480-114567502 CTGATTTTGAAGATGAAGCAAGG + Intronic
936741585 2:115518002-115518024 CTGCATGTGCAGAGATAACATGG + Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
938641692 2:133287762-133287784 ATGCATGTGAAGAGGTAGGGAGG + Intronic
939462432 2:142514104-142514126 CTGCCTTTGAAGATGAAGGAAGG - Intergenic
940071301 2:149691041-149691063 CTGGCTTTGAAGATGAAGCAAGG - Intergenic
942550325 2:177108891-177108913 TTGAATGTGAAGATTTATCAGGG + Intergenic
942816686 2:180060711-180060733 CTGAATGCGAAGATGGAACAAGG + Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
1169090512 20:2858721-2858743 CTGCATGGGAAGTTGGAGTAGGG - Intronic
1171399754 20:24865256-24865278 TTCCATGGGAAGCTGTAGCAGGG - Intergenic
1172510411 20:35497020-35497042 CTGGTTGGCAAGATGTAGCAGGG + Intronic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1174543275 20:51306445-51306467 CTGCATTTGAAGCAGGAGCATGG + Intergenic
1175056733 20:56205549-56205571 CTGCATGGGAAAATCCAGCAAGG - Intergenic
1175204773 20:57303108-57303130 CTGCAGGTGCAGATGTTCCAAGG - Intergenic
1175287668 20:57848277-57848299 CTGCAGGGGAAGCAGTAGCAGGG - Intergenic
1175363522 20:58433802-58433824 CTGCATGTGAAGTTGTCTCAGGG + Intronic
1175641748 20:60636015-60636037 CTACCTGTGAAGATGGAGGAAGG - Intergenic
1175646862 20:60682088-60682110 CTGCATGTGGAGATGTAAAATGG - Intergenic
1175711160 20:61222150-61222172 CTGGCTGTGAAGATGCAGGAAGG + Intergenic
1178011523 21:28291650-28291672 CTCCATGTGAAGATGAGGAAAGG + Intergenic
1179074183 21:38103084-38103106 CTGCATTTGAGGATGTAGCAGGG + Intronic
1182807025 22:33081395-33081417 TTGCATGTGAAGACGTAGGGAGG + Intergenic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184661974 22:45969590-45969612 CTGCAAGTCAGCATGTAGCAGGG + Intronic
950319555 3:12037509-12037531 CTCCATGTTATGATGTAGCAAGG - Intronic
950894563 3:16437021-16437043 TTGCATGGGAACTTGTAGCATGG - Intronic
951293600 3:20904532-20904554 ATGAATCTGAAGATGTAGCTGGG + Intergenic
951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG + Intergenic
951872918 3:27385183-27385205 CTGAATGGGAAAATGGAGCAAGG + Intronic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
955238818 3:57162874-57162896 CTGCATGAGAAGGTAAAGCAAGG + Intronic
955463209 3:59208369-59208391 CTGCCTTTGAAGATGAAGGAAGG + Intergenic
955660867 3:61297673-61297695 GTGCATGTGGAGAGGAAGCAAGG + Intergenic
955686997 3:61559049-61559071 TTGGATGTGAAGTTTTAGCATGG + Intergenic
956495292 3:69819315-69819337 CTGCATCTGGACATTTAGCAGGG - Intronic
957128996 3:76199252-76199274 CTGGCTTTGAAGATGTAGGAAGG + Intronic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
959343385 3:105160454-105160476 CTGAAAGTGAAGATGTGGTATGG - Intergenic
959969745 3:112396291-112396313 ATGCATGTCAAGAAGTAGAAGGG - Intergenic
961476853 3:127152429-127152451 CAGCATGTGAAGATGCAAGAAGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964524677 3:157605878-157605900 GAGCATGAGAAAATGTAGCATGG - Intronic
966236588 3:177708329-177708351 CTGCATGTGAAAATGTACTCTGG - Intergenic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
967370671 3:188742186-188742208 CTGCAGTTGAGGATGTAACATGG + Intronic
967402806 3:189082835-189082857 GTGCATGAGTAAATGTAGCAGGG - Intronic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969973024 4:11067423-11067445 CATCATGTGAAGATGAAGGAGGG - Intergenic
972031102 4:34459122-34459144 CTGTCTATGAAGATATAGCAAGG + Intergenic
972451521 4:39204422-39204444 CAGAATGTTAAGATGTGGCAGGG - Intronic
977227300 4:94407898-94407920 CTTCTTGTGAAGATTTACCAGGG + Intergenic
979997745 4:127452646-127452668 ATGCATGTAAAGAAGTAGAAAGG + Intergenic
980300292 4:130982481-130982503 ATGTATGTGAGGATGTAGAAGGG - Intergenic
984550503 4:181153633-181153655 CTGCATGTGGAGGTATGGCACGG - Intergenic
985905464 5:2831588-2831610 CTGCAGGTGCAGACGTGGCAGGG + Intergenic
988249336 5:28735008-28735030 CTTCATGGGAAAATGAAGCAGGG - Intergenic
988428016 5:31086570-31086592 CACCATGTGAAGGTGTAGAATGG - Intergenic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
990402746 5:55455832-55455854 CTGATTGAGAAGATTTAGCATGG - Intronic
991183348 5:63779905-63779927 CACCATGTGAAGATACAGCAAGG - Intergenic
992001155 5:72437840-72437862 TCCCATGTGAGGATGTAGCAAGG - Intergenic
995437788 5:112157590-112157612 CTGGCTTTGAAGATGTAGGAAGG - Intronic
995730397 5:115234057-115234079 GTGGATGTGCAGATGTACCATGG - Intronic
996232951 5:121088411-121088433 CTGCATAGGAAGAGGAAGCATGG + Intergenic
996399479 5:123046209-123046231 TTGAATTTGAAAATGTAGCAGGG + Intergenic
997032877 5:130152149-130152171 TTTCATGTGAAGATGCAGCTGGG - Intronic
1001442093 5:171750864-171750886 CCGCATGTGTAGAATTAGCAGGG - Intergenic
1002579389 5:180198556-180198578 CCCCATGTGAAGATGCAGGAGGG - Intronic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1006594616 6:35183812-35183834 AAGCATGTAAAGATGTACCAAGG - Intergenic
1006938678 6:37736847-37736869 ATGTATGTGAAAATGCAGCATGG + Intergenic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1007451656 6:41944780-41944802 CTGGATGTGAACCTGTAGTATGG + Intronic
1009054893 6:58322771-58322793 CTGCATGAGAAGATGAACCAGGG + Intergenic
1009236258 6:61127801-61127823 CTGCATGAGAAGATGAACCAGGG - Intergenic
1011074710 6:83426076-83426098 CGCCATGGGATGATGTAGCAAGG + Intronic
1011736123 6:90312342-90312364 CTGCTAGTGGAGATATAGCAGGG - Intergenic
1011837410 6:91450496-91450518 ATGCATGTGAAGGGGTAGAAAGG - Intergenic
1013392576 6:109701542-109701564 CTGCATGTGTCTATTTAGCAGGG + Intronic
1014080508 6:117281351-117281373 ATGCCTGTGATGATGTTGCAGGG + Intergenic
1014912304 6:127109634-127109656 TTCCATGTGAAGACATAGCAAGG - Intergenic
1015567521 6:134588739-134588761 GTGGATTTGAAAATGTAGCAGGG - Intergenic
1016250981 6:142042704-142042726 TTGCATGTCCAAATGTAGCAAGG - Intergenic
1017547816 6:155470266-155470288 ATGCATGTGAAGACAGAGCATGG - Intergenic
1017879942 6:158554683-158554705 CTTCATGGTAAGATCTAGCATGG - Intronic
1018887850 6:167956578-167956600 CTCCATGTGGAGATGTTACATGG - Intronic
1020506733 7:8999443-8999465 ATGCATGTGAAGAAGTTGTAGGG - Intergenic
1022963561 7:35453032-35453054 CTGCAGGTGAAAATGTAAAATGG + Intergenic
1023556312 7:41426807-41426829 ATGGAGGTGAAGATGTGGCAGGG - Intergenic
1023854540 7:44174291-44174313 CTGCATGTGCAGATATCACATGG - Intronic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1030511990 7:110493992-110494014 CAGCATGTGAAGATGTTGTGTGG + Intergenic
1031448383 7:121882960-121882982 GGGAAGGTGAAGATGTAGCATGG + Intronic
1031656213 7:124359549-124359571 ATCCATGTGAAGATACAGCAAGG - Intergenic
1031980316 7:128120435-128120457 CTGCATGGGAATATGTGGGAAGG + Intergenic
1034627179 7:152502653-152502675 TTACATGTGAAGATGTGGAATGG + Intergenic
1034718802 7:153268437-153268459 CTGAATGTAAAGCTGTAGCATGG + Intergenic
1034753594 7:153593382-153593404 CTGGAGGTGAAGATTTTGCATGG - Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035214212 7:157352686-157352708 CTGCTTGTGATGAAGTAGAAAGG - Intronic
1036118884 8:5992884-5992906 CACCATGTGAGGCTGTAGCAAGG - Intergenic
1036282276 8:7410742-7410764 CTGGATTTGAAGATGAAGGAAGG - Intergenic
1036339192 8:7900828-7900850 CTGGATTTGAAGATGAAGGAAGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038410368 8:27353840-27353862 CTGCTATTGAAGATGAAGCAGGG + Intronic
1038924732 8:32126016-32126038 ATGCATGTGAAGAATTAGAAAGG - Intronic
1039393466 8:37202145-37202167 CTACCTGTGAAAATGCAGCAGGG + Intergenic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1046301411 8:112296692-112296714 CTCCATGTTAAGAAGAAGCAAGG + Intronic
1046489799 8:114936658-114936680 CTGCCCTTGAAGATGGAGCAAGG + Intergenic
1049302813 8:141880532-141880554 CTGCTTGTGAGGATGAAGCAGGG - Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1050667259 9:7953654-7953676 CACCTTGTGAAGATGTAGCCAGG + Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1052593926 9:30535148-30535170 CTACATGTCAATATGTTGCATGG - Intergenic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1055494361 9:76840019-76840041 AAGCATGTGAAGATGTAACGTGG + Intronic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1056006331 9:82275422-82275444 TTTCCTGAGAAGATGTAGCAGGG - Intergenic
1059047973 9:110891931-110891953 CTGCTGGTGAAAATGTAACATGG + Intronic
1060517441 9:124274811-124274833 CTGCATGTCCATTTGTAGCAAGG + Intronic
1061916051 9:133754828-133754850 CTGGCTTTGAAGATGGAGCATGG + Intergenic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1188768958 X:34130192-34130214 CAGCGTGTGAAGATGAAGTATGG - Exonic
1189007651 X:37011204-37011226 CAGCATGTGAAGATGGGGTATGG + Exonic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1190393697 X:49958012-49958034 CTGCATGTGATAAAGTTGCATGG - Intronic
1193085015 X:77441210-77441232 CTGCATTTGAAGCTGTAGCGAGG - Intergenic
1193983745 X:88215267-88215289 CTGGTTTTGAAGATGTAGGAAGG - Intergenic
1195052045 X:101105983-101106005 CTGCATGTAAAGATCTAGTAGGG - Intronic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1199092788 X:143711702-143711724 GAGCATGTGAATATGTAGAAGGG - Intergenic
1199538611 X:148932172-148932194 CTGCTTGTGAGGATGAATCATGG + Intronic
1199688276 X:150284114-150284136 TTCCATGTGAAGATACAGCAAGG - Intergenic
1199735321 X:150680672-150680694 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1199759045 X:150891403-150891425 CTGGCTTTGAAGATGGAGCAAGG - Intronic