ID: 1099416471

View in Genome Browser
Species Human (GRCh38)
Location 12:82393332-82393354
Sequence GAGATCTTTAACTTCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099416469_1099416471 20 Left 1099416469 12:82393289-82393311 CCTCATCAATTTATTTCATCAAT 0: 2
1: 10
2: 193
3: 804
4: 1597
Right 1099416471 12:82393332-82393354 GAGATCTTTAACTTCTTTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099416471 Original CRISPR GAGATCTTTAACTTCTTTGG TGG Intronic
903365625 1:22803979-22804001 GAGATCTGGAATTTCTGTGGTGG + Intronic
908131676 1:61081552-61081574 GACATCTTTTACTTTTTAGGAGG - Intronic
909740431 1:79022824-79022846 GAGATTTGTAAATTCTTTGAAGG - Intergenic
910415867 1:86997547-86997569 GTGATCTTTATCTTATATGGAGG + Intronic
910453306 1:87369564-87369586 GAGATCTATAATTTTTTTCGAGG - Intergenic
914731506 1:150374861-150374883 TAGATTTATTACTTCTTTGGGGG - Intronic
915912061 1:159921702-159921724 GGTTTCTTTAACTTCGTTGGAGG + Intronic
916668263 1:166987777-166987799 CTGATCTTTTACATCTTTGGAGG - Intronic
917398790 1:174623274-174623296 GAGATCTTCAAATTTTTTGATGG + Intronic
918449827 1:184647464-184647486 TAGATCTTCCACTTTTTTGGTGG - Intergenic
918744274 1:188180452-188180474 GACATATTTAACTTCTTTCCTGG + Intergenic
918929243 1:190832894-190832916 GAGATTTTGAATTCCTTTGGTGG - Intergenic
922023278 1:221725996-221726018 CAGATCTTGGACCTCTTTGGTGG - Intronic
923343286 1:233025543-233025565 GAGAATTGTGACTTCTTTGGGGG - Intronic
1063615558 10:7597067-7597089 AAGGTCTTTGATTTCTTTGGTGG - Intronic
1063816477 10:9780212-9780234 TAGATATTTATTTTCTTTGGAGG + Intergenic
1068260980 10:54581371-54581393 GAGATCTTTCACCTCTTTGTTGG - Intronic
1068633947 10:59327817-59327839 TAGATTTTAAAGTTCTTTGGGGG - Intronic
1071319525 10:84439753-84439775 GAGATTGTTAACTTCTCTTGAGG + Intronic
1073614662 10:104981425-104981447 AAGCTCTATAACTTCTTTTGAGG + Intronic
1074197380 10:111201456-111201478 GAGCTCTGTAGCTCCTTTGGGGG + Intergenic
1074353628 10:112761991-112762013 CAGCCATTTAACTTCTTTGGAGG - Intronic
1079461237 11:20680024-20680046 GGGATTTTCAGCTTCTTTGGTGG + Intronic
1079814692 11:25040753-25040775 GAGATCATCAACTTCTTTAAAGG - Intronic
1084096013 11:66912085-66912107 TAGATTTTTAATTTCTTTTGAGG - Intronic
1087650591 11:100862415-100862437 GAAATCTTTTTCTTATTTGGAGG + Intronic
1089586886 11:119515315-119515337 TAGAACTTTAGGTTCTTTGGGGG + Intergenic
1089889252 11:121863518-121863540 GAGAACTTTCACTTGTCTGGAGG + Intergenic
1090456978 11:126858485-126858507 GAGATTGCTAACTTCTTAGGAGG - Intronic
1094069929 12:26402011-26402033 GAGAACTAGAACTCCTTTGGAGG + Intronic
1095062943 12:37723924-37723946 GAGCACTTTGAGTTCTTTGGTGG + Intergenic
1096946861 12:55416099-55416121 GAGGTCTTTCACCTCCTTGGTGG + Intergenic
1098214899 12:68205295-68205317 CAGGTTTTTAACTTCATTGGTGG - Intronic
1098687065 12:73435005-73435027 GAGATCTGTGACTGATTTGGGGG + Intergenic
1098866683 12:75771724-75771746 AAAATCTTTAACTTCTTAGAGGG + Intergenic
1099416471 12:82393332-82393354 GAGATCTTTAACTTCTTTGGTGG + Intronic
1100274186 12:93056803-93056825 GAGATCTTTAAATGCTAGGGAGG - Intergenic
1101463195 12:104918203-104918225 TAAATGTTTAACTTCTTTGGTGG + Intronic
1106008953 13:25799437-25799459 CATATTTTTAACTCCTTTGGTGG + Intronic
1106455790 13:29925426-29925448 GAGAACTCTACCTACTTTGGTGG - Intergenic
1106968430 13:35103695-35103717 GAGTTCTTTATCTTATTTAGTGG + Intronic
1109266079 13:60201855-60201877 GAGATTTTGAACATCTTTGGGGG + Intergenic
1110027468 13:70559243-70559265 GAGATATTTAAATTGTTTTGAGG - Intergenic
1110185327 13:72667680-72667702 CAGATCTTCATCTTCTTTGAGGG - Intergenic
1112684305 13:101805573-101805595 CAAATCTTTAACTTCTCTGTAGG - Intronic
1113991961 14:16035003-16035025 GAGAATTTTAACTTTCTTGGTGG + Intergenic
1114419145 14:22565743-22565765 GAGATCTGTAACTTGTGAGGTGG + Intronic
1119213277 14:72849039-72849061 AAGTTATTTAACTTTTTTGGGGG - Intronic
1120023939 14:79560865-79560887 GAACACTTTAAGTTCTTTGGTGG - Intronic
1202941698 14_KI270725v1_random:154392-154414 GAGATGTTAAACTTCTCTGATGG - Intergenic
1124329991 15:28803118-28803140 GAGTTCTTTACCTATTTTGGAGG + Intergenic
1127156285 15:56129002-56129024 TAGATCTTTAATTTCTTTCAAGG - Intronic
1130712129 15:86293641-86293663 GAGAACGTGAACATCTTTGGGGG + Intronic
1130809924 15:87365981-87366003 GAGCTCTTTTCTTTCTTTGGGGG - Intergenic
1131583169 15:93665173-93665195 GAGGTCTGTAACATCTTTGGAGG - Intergenic
1134909957 16:18016465-18016487 ATGATCTTTAAATGCTTTGGAGG + Intergenic
1135675545 16:24411934-24411956 GAGAGCTTTAATTGCTCTGGAGG + Intergenic
1137078055 16:36000963-36000985 GAGATCTTTGAGGTCTATGGTGG + Intergenic
1138496798 16:57413827-57413849 GACCTATTTAACCTCTTTGGGGG - Intronic
1140717953 16:77743813-77743835 GAGATCTTCTACTTCTTATGTGG + Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1151048292 17:70947631-70947653 CAGACCTTCAGCTTCTTTGGTGG - Intergenic
1151460095 17:74249275-74249297 GAGATCTCTATCATCCTTGGTGG - Intronic
1153182146 18:2446864-2446886 GGGTTCTTTAACTTGGTTGGGGG + Intergenic
1154069948 18:11145170-11145192 GAGATATTTAAAGTTTTTGGTGG + Intronic
1154236360 18:12609886-12609908 TAGATCTTTAACATCTCTGAAGG + Intronic
1155752758 18:29449241-29449263 GAGATATTTAAATTCTTTGTAGG - Intergenic
1156285445 18:35690113-35690135 GAGATTTTTAACTTGGTGGGGGG + Intronic
1157408260 18:47441808-47441830 GGGACTTCTAACTTCTTTGGTGG + Intergenic
1157815723 18:50728361-50728383 AAGATCTTCAGCTTCTCTGGAGG + Intronic
1158645238 18:59240212-59240234 GAGAGATTTAACTTGTTTGAAGG + Intergenic
1158751791 18:60270657-60270679 GAGTTCGTGTACTTCTTTGGAGG + Intergenic
1161265772 19:3363674-3363696 GAGATCTTGAATTTCCTTGCTGG + Intronic
928383512 2:30842978-30843000 TAGATCTTTAATTTCTTTCAAGG - Intergenic
932454189 2:71835724-71835746 GAAATCTTTAACTGCTGAGGTGG - Intergenic
935689932 2:105721826-105721848 GAGATGTTTAACCTTGTTGGAGG - Intergenic
937179412 2:119976901-119976923 GAGATGTTTGTCTTTTTTGGGGG + Intronic
937731959 2:125243522-125243544 GAATTATTTAACTTTTTTGGGGG - Intergenic
938508446 2:131912635-131912657 GAGATATTTAAATTGTTTGCTGG + Intergenic
938539776 2:132276262-132276284 GAGAATTTTAACTTTCTTGGTGG - Intergenic
939241691 2:139569339-139569361 AAGATCTATAAGTTTTTTGGGGG - Intergenic
942295050 2:174508627-174508649 GAGATACTTCACTTGTTTGGGGG + Intergenic
943707717 2:191053159-191053181 AAGATCTTTGAATTGTTTGGAGG - Intronic
944066159 2:195621416-195621438 GAGTTCTTTGACTTCTTTGAAGG + Intronic
944438640 2:199718912-199718934 GAGTTGTTTAAGTTCTTTGTAGG + Intergenic
947522322 2:230856707-230856729 GTGATGTTGAAATTCTTTGGTGG - Intergenic
947806366 2:232971188-232971210 CAGATCATGAGCTTCTTTGGTGG + Intronic
1170317732 20:15060946-15060968 GTGATTTTTAACTTGTGTGGGGG + Intronic
1171057551 20:21922008-21922030 TAGATATTTTATTTCTTTGGTGG + Intergenic
1171537602 20:25909554-25909576 GAGATGTTAAACTTCTCTGATGG - Intergenic
1171803482 20:29650945-29650967 GAGATGTTAAACTTCTCTGATGG + Intergenic
1171808196 20:29708624-29708646 GAGATCTTTAAGACCTGTGGTGG - Intergenic
1171825555 20:29900009-29900031 GAGTGCTTTGACTTCTATGGTGG + Intergenic
1171840545 20:30204876-30204898 GAGATGTTAAACTTCTCTGATGG - Intergenic
1171868702 20:30509207-30509229 GAGAATTTTAACTTTCTTGGTGG - Intergenic
1173630816 20:44513753-44513775 GAGATTTTTTACTTATATGGGGG - Intronic
1174101038 20:48126314-48126336 GAGATCTTGATCTGCTTTGAGGG - Intergenic
1174876032 20:54227335-54227357 GAGAACATTAATTTTTTTGGGGG - Intronic
1175131420 20:56792559-56792581 GAGATCATAGACATCTTTGGTGG - Intergenic
1176581467 21:8532543-8532565 GAGATGTTAAACTTCTCTGATGG + Intergenic
1177474804 21:21606308-21606330 GAGATCTTTTGCTTCTTTCTAGG + Intergenic
1178167854 21:30002546-30002568 CAGTTCTTTAACTTATTTGTAGG - Intergenic
1178575834 21:33789508-33789530 TAGATATTTAACTTTTTTGAAGG - Intronic
1178694106 21:34778495-34778517 TAGATGTTTAACTTCTTTCATGG + Intergenic
1180315309 22:11272523-11272545 GAGAATTTTAACTTTCTTGGTGG - Intergenic
949757402 3:7428287-7428309 AAGAGCTTTCACTTCTCTGGTGG + Intronic
949975408 3:9453340-9453362 GAGATCTTTATCTTCCTTCTAGG + Intronic
951869473 3:27344986-27345008 GGTATTTTTAACCTCTTTGGTGG - Intronic
952007077 3:28854354-28854376 AAAATCTTTAGTTTCTTTGGGGG + Intergenic
953517183 3:43605795-43605817 GAGTTCTTTCACACCTTTGGTGG - Exonic
954521958 3:51236242-51236264 GAGATCTTTCACTTTTTTATTGG + Intronic
955777405 3:62448604-62448626 GGGATATTGAACTTTTTTGGGGG + Intronic
955930990 3:64056726-64056748 GACGTCTTTAAATTCCTTGGGGG + Intergenic
961283480 3:125781606-125781628 GAAATCATTCAATTCTTTGGAGG + Intergenic
961709847 3:128819760-128819782 GAGATCTTTAATTTTTTTTAAGG - Intergenic
961908403 3:130287046-130287068 GAGGTCTTTCACCTTTTTGGGGG - Intergenic
964293313 3:155206054-155206076 AAGAGCTGTAACTTCTTTGAGGG - Intergenic
964659499 3:159104689-159104711 AAGATCTTCTACTTCTTTAGAGG - Intronic
970049715 4:11899690-11899712 GGGATCTTTAATTTCTTCTGAGG - Intergenic
970335467 4:15035727-15035749 GAGTTATTTTACTTTTTTGGGGG - Intronic
971438558 4:26654790-26654812 AAGGTTTTTAACTTCTTTGATGG + Intronic
972129402 4:35811456-35811478 TAGATTATGAACTTCTTTGGAGG + Intergenic
972779840 4:42277581-42277603 GAAGTCTTTAATTGCTTTGGAGG - Intergenic
976200162 4:82570117-82570139 GAGACCTTTAACTTCTAAGAGGG - Intergenic
976937467 4:90654741-90654763 CACAACTTAAACTTCTTTGGAGG + Intronic
977570352 4:98622459-98622481 TAATTCTTTAACTTTTTTGGGGG + Intronic
978498705 4:109386319-109386341 CAGTTCTTTCACTTCTCTGGTGG - Intergenic
978607379 4:110495799-110495821 GAGCCCTTGAATTTCTTTGGGGG + Intronic
979455815 4:120924239-120924261 AAGATCTCTAACTTCTCTAGGGG + Intergenic
979613935 4:122719980-122720002 GAAAACTTAATCTTCTTTGGAGG + Intergenic
981193242 4:141887848-141887870 CACAACTTTAGCTTCTTTGGGGG + Intergenic
983679806 4:170340505-170340527 GAGAACATTAACTTATTTAGGGG + Intergenic
984043579 4:174769194-174769216 TAAATCTTTATCTTCTTTGTGGG - Intronic
989092756 5:37751077-37751099 TAGATATTTAACTTCTCAGGGGG - Intronic
989944890 5:50211174-50211196 GAGATATTTGATTTCTATGGTGG - Intergenic
990537824 5:56740794-56740816 GATATGTATATCTTCTTTGGAGG - Intergenic
990867115 5:60391782-60391804 GAGAACATAAACCTCTTTGGGGG + Intronic
993260948 5:85657459-85657481 TAAATCTTTAAGTTCTATGGTGG - Intergenic
993858808 5:93108795-93108817 AAGATCTTGAACTTCTTTTGAGG - Intergenic
995886205 5:116896921-116896943 AAGATGTTTAACATCATTGGGGG - Intergenic
996003770 5:118395555-118395577 GGGGTCTTGAACTTATTTGGTGG - Intergenic
997435631 5:133872704-133872726 TGGATCTTTCTCTTCTTTGGGGG - Intergenic
1000259794 5:159576754-159576776 TAGATCTTTTACTTCTTTGTAGG + Intergenic
1005258511 6:24031353-24031375 GAAATCTTAAACCTTTTTGGAGG - Intergenic
1005735654 6:28743239-28743261 GACATCTTTGCCTTCTTTGAAGG + Intergenic
1007857177 6:44870060-44870082 GAAATGTTGAAATTCTTTGGGGG - Intronic
1010597285 6:77779173-77779195 CAATTCTTTAACTTCTTTGCAGG - Intronic
1013143733 6:107366194-107366216 GAGATCTTTAACTTGTGTTGTGG - Intronic
1017035935 6:150267288-150267310 TAGAACTTTAACATCTTTTGGGG + Intergenic
1017966580 6:159271920-159271942 GATATATTTATTTTCTTTGGTGG - Exonic
1021100888 7:16585293-16585315 GAGTTCTTTTACATCTGTGGGGG + Intergenic
1023159024 7:37279565-37279587 GAGACCTTCAGCTTCTTTAGTGG - Intronic
1025289800 7:57706485-57706507 GAAAACTACAACTTCTTTGGAGG + Intergenic
1025568982 7:62532052-62532074 GAGTTCTTTAAGTCCTGTGGTGG + Intergenic
1029173816 7:98649564-98649586 GATATCTTTAATTAGTTTGGGGG - Intergenic
1030589440 7:111463293-111463315 CAGATCTTCAACTTTTCTGGGGG + Intronic
1031609146 7:123804679-123804701 TAGACCTTGAACTTCTTGGGCGG + Intergenic
1031793417 7:126139426-126139448 GAGTTTTTTAACTAATTTGGAGG + Intergenic
1033626134 7:143111353-143111375 GAGGACTTGGACTTCTTTGGAGG + Intergenic
1037382550 8:18302717-18302739 GAGATCTTTCACTTCTTTTATGG + Intergenic
1037725781 8:21481638-21481660 AAGATCTGTAACTAATTTGGTGG + Intergenic
1039160991 8:34619711-34619733 CATATCTTTAACTTATTTGGTGG + Intergenic
1039230020 8:35435026-35435048 AAGATCTTTAACTTTTTTTTAGG - Intronic
1040765552 8:50905576-50905598 GAGAAATTTGACATCTTTGGTGG + Intergenic
1043018373 8:74969537-74969559 GGGATCTTTTACTACTTTGTAGG + Intergenic
1043242351 8:77951277-77951299 CACATCTTTTACTTCCTTGGAGG + Intergenic
1048654780 8:136523595-136523617 GAGTTCTTTCACTGGTTTGGGGG - Intergenic
1049262812 8:141648900-141648922 GAGATTTTAAACATCTATGGGGG + Intergenic
1051578092 9:18640363-18640385 GACATCTTTCACTTCTTTACTGG - Intronic
1055693802 9:78861206-78861228 GAGTTCTTGAACTACTTTTGAGG - Intergenic
1061675429 9:132212933-132212955 GGGATCTTGGTCTTCTTTGGGGG - Intronic
1203356612 Un_KI270442v1:154915-154937 GAGTGCTTTGACATCTTTGGTGG - Intergenic
1203356666 Un_KI270442v1:156112-156134 GAGTGCTTTGACTTCTATGGTGG - Intergenic
1203363598 Un_KI270442v1:238434-238456 GAGAATTTTAACTTTCTTGGTGG - Intergenic
1203611483 Un_KI270749v1:10585-10607 GAGATGTTAAACTTCTCTGATGG + Intergenic
1187282107 X:17865214-17865236 GAGATTCTTAACTTCTTAAGGGG + Intergenic
1187463997 X:19512909-19512931 GAGCTCTGTATCTTTTTTGGTGG + Intronic
1188438962 X:30195477-30195499 GAGATCATTTACTGCTTCGGGGG + Intergenic
1188784824 X:34332863-34332885 GGGATCTTTAGCTTCTATAGTGG - Intergenic
1190250478 X:48720391-48720413 AAGGTCTTTAACCTCTTTGAGGG - Intergenic
1190376760 X:49795941-49795963 GAGATCTTTCAGCTTTTTGGAGG + Intergenic
1192985870 X:76397809-76397831 AAGATATTTACCTGCTTTGGTGG + Intergenic
1195404958 X:104502738-104502760 GAAATCTTTTCTTTCTTTGGTGG - Intergenic
1195840151 X:109167601-109167623 GGTATCTGTAATTTCTTTGGTGG + Intergenic
1196101919 X:111855638-111855660 GAGATCATGAACATGTTTGGAGG - Intronic
1197848692 X:130833281-130833303 TATATCTCTATCTTCTTTGGGGG + Intronic
1201074718 Y:10178405-10178427 GAGAATTTTAACTTTCTTGGTGG + Intergenic
1201079933 Y:10232033-10232055 GAGAGCTTTGAGGTCTTTGGTGG - Intergenic
1201096599 Y:10625875-10625897 GAGCTCTTTGAGTCCTTTGGTGG - Intergenic