ID: 1099418815

View in Genome Browser
Species Human (GRCh38)
Location 12:82426875-82426897
Sequence GTGTTGTGGTAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 446}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099418815 Original CRISPR GTGTTGTGGTAGAGGGAAGA TGG (reversed) Intronic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
903724164 1:25428876-25428898 GTGTTGGGGCAGAGGCAGGAAGG + Intronic
905287128 1:36888810-36888832 GTGTTGTGGTACAAGCAGGAAGG - Intronic
905425596 1:37881421-37881443 GTGTGGTGCTCCAGGGAAGAGGG - Intronic
905601433 1:39255360-39255382 GGTTTGTGGTAGAAAGAAGATGG + Intronic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
905827335 1:41035830-41035852 GTGCTGTGGTGGAGGGGTGAAGG - Intronic
907078778 1:51602326-51602348 GTGTTAGGGTAGAGGCAGGATGG - Intronic
907417383 1:54323806-54323828 GGGTTGTGGTAGAGGGAGATAGG + Intronic
907588825 1:55646258-55646280 TTGTTGTGGTATGGAGAAGAGGG - Intergenic
907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG + Intronic
907988978 1:59560789-59560811 GTGTGGTGGAAGTAGGAAGAAGG + Intronic
908962029 1:69709695-69709717 GAGTTGTGTTATAGGAAAGACGG + Intronic
910159432 1:84257715-84257737 GTCTTGTGGTCAAGGGGAGAAGG + Intergenic
910682852 1:89885016-89885038 GTGGTGTGGTTGTGGGGAGATGG - Intronic
910938050 1:92503122-92503144 GTGTTGTGGCAGAGGGCAAAGGG - Intergenic
911459600 1:98172805-98172827 GTGTTGTGTTAGACTGCAGAAGG - Intergenic
911728525 1:101267561-101267583 ATATTGTGGTAAAAGGAAGAGGG - Intergenic
912923254 1:113889687-113889709 GTGTTGGGGCAGAGGGTATATGG + Intergenic
912988478 1:114458924-114458946 GTGTTGTAGTAATGGGAAGCTGG + Intronic
913142523 1:115955554-115955576 GTATAGAGGGAGAGGGAAGAGGG + Intergenic
913425130 1:118720280-118720302 GTGTTTTGGTAGAGGAACAAGGG - Intergenic
913705414 1:121417036-121417058 GTGAGGTGGAAGAAGGAAGACGG - Intergenic
915193477 1:154171646-154171668 GTTCTATGGTAGAGGGAGGAGGG - Intronic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917288578 1:173447480-173447502 GTGTAGGGGTAGAGGGCATATGG + Intergenic
917442699 1:175081015-175081037 TTGTTTTGGTAGAGGGATGCAGG + Intronic
918978652 1:191525736-191525758 GTGTAGGGGTAGAGGGTATATGG + Intergenic
919359030 1:196567272-196567294 GTGGTCTAGTAGATGGAAGAGGG - Intronic
920120276 1:203650833-203650855 TGGTGGTGGTAGAGGGAGGAAGG - Intronic
920536313 1:206738943-206738965 TTTTAGTGGCAGAGGGAAGAGGG - Intergenic
921088124 1:211815676-211815698 GTTTAGTGGTTGAGGGAAGCTGG - Intronic
923152173 1:231243220-231243242 GTGTTGTGGGAGAGACAAGAAGG + Intronic
923451984 1:234126604-234126626 GTGATGTGGTAGGAAGAAGATGG - Intronic
923763424 1:236869700-236869722 AGGTTGTGGTAGAGGTGAGAGGG + Intronic
924482159 1:244445783-244445805 CTGCTGTGGTAGAGAGATGAAGG + Intronic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1062959089 10:1559225-1559247 TTGCTGTGGGAGAGGAAAGAGGG + Intronic
1063524077 10:6768012-6768034 GTGTGGTGGAAGAGGGAGGTGGG + Intergenic
1067368469 10:45659278-45659300 GTGGTGAGGTATTGGGAAGAGGG - Intronic
1067450351 10:46378222-46378244 GTGCTGGGGCAGAGGGAAGCCGG + Intronic
1067456185 10:46420899-46420921 GGGGTGGGGAAGAGGGAAGAAGG + Intergenic
1067586894 10:47481541-47481563 GTGCTGGGGCAGAGGGAAGCCGG - Intronic
1067631014 10:47963740-47963762 GGGGTGGGGAAGAGGGAAGAAGG - Intergenic
1067633950 10:47989308-47989330 GTGCTGGGGCAGAGGGAAGCCGG - Intergenic
1067893732 10:50157664-50157686 GTTTTGGGGTGGGGGGAAGAGGG + Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1070643637 10:78186475-78186497 TTGTTGTGGTAGTGGAGAGAAGG - Intergenic
1072062273 10:91825106-91825128 TTGTTTTGGTCGAGGGGAGAGGG + Intronic
1072225044 10:93361105-93361127 GTTGTGGGGTAGAGGGAGGATGG + Intronic
1072248737 10:93565554-93565576 GTAATATGGCAGAGGGAAGAGGG + Intergenic
1072574787 10:96689768-96689790 ATTGTGGGGTAGAGGGAAGACGG - Intronic
1072656186 10:97332177-97332199 GTGCTGTGGTGGAGGGAGGTGGG - Intergenic
1074476819 10:113781455-113781477 GTGTTGGGGAAGGGGGAAGGAGG - Intronic
1075237283 10:120742367-120742389 GTGATGTTGCAGAGGTAAGATGG - Intergenic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1076088220 10:127654658-127654680 GAGGAGTGGTAGAGGGAAGGAGG - Intergenic
1077463544 11:2722794-2722816 CTGGTGGGGTAGAGGGAAGGAGG - Intronic
1078442454 11:11378882-11378904 GAGGTGTGGTAGAGGGGAGGGGG - Intronic
1078532945 11:12151064-12151086 GTGATGTGGTAGAAAGAACATGG - Intronic
1078800318 11:14637166-14637188 GATTTGTGGGGGAGGGAAGATGG - Intronic
1079257616 11:18845991-18846013 ATGTTGTGGTAGATGCAAGTTGG + Intergenic
1079281693 11:19092895-19092917 GGGGTGTGGGAAAGGGAAGAGGG + Intergenic
1079414170 11:20217491-20217513 CTGCTGAGGTAGAGGCAAGATGG - Intergenic
1079545236 11:21626011-21626033 GAATCGCGGTAGAGGGAAGATGG + Intergenic
1079878600 11:25893771-25893793 ATTTTGAGGTGGAGGGAAGAAGG + Intergenic
1080123705 11:28706186-28706208 CTGCTATGGTTGAGGGAAGAAGG + Intergenic
1081362664 11:42199452-42199474 GTGTCGAGGTAGGGAGAAGAAGG - Intergenic
1081485733 11:43526751-43526773 GTGTTGTGCTTCAGGGAATAGGG + Intergenic
1082268137 11:50141837-50141859 GTGTTGTGGGAGAGACTAGAAGG + Intergenic
1082648138 11:55753380-55753402 GTTGTGGGGTAGGGGGAAGAAGG + Intergenic
1082652649 11:55812471-55812493 GTGTTGGAGTACAGAGAAGAAGG + Intergenic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1084175380 11:67419994-67420016 GGGTTGCAGGAGAGGGAAGACGG - Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084720223 11:70900813-70900835 GTCTTCTGGGAGAAGGAAGAGGG + Intronic
1085024575 11:73229124-73229146 GTGTTGGGGTAGAGGATGGAAGG + Intronic
1086414710 11:86577024-86577046 CTGTTGTGGTAGAAGCAGGATGG + Intronic
1087651043 11:100867894-100867916 GTGTCGGGGAAGAGGGAAGCTGG + Intronic
1087678537 11:101191055-101191077 CTGTTGTGGTGGGGGGAAGGGGG - Intergenic
1087721371 11:101669620-101669642 GTGGTGTTCTAGAGGCAAGAAGG - Intronic
1087930011 11:103966190-103966212 GGGTGGAGGAAGAGGGAAGAAGG + Intronic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1089742112 11:120591605-120591627 AGGCTGTGGTGGAGGGAAGAGGG - Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091752197 12:3029992-3030014 GTGTTCTGGTAGTGGGATAAAGG + Intronic
1091851133 12:3697918-3697940 GTGATGTGGAAGAGGGCATACGG + Intronic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1092967400 12:13657662-13657684 GTGTTGGGGGGCAGGGAAGAGGG + Intronic
1093319203 12:17691838-17691860 GTCGTGTGGTAGGGGGAGGAGGG + Intergenic
1094572635 12:31654748-31654770 TGGTTGTGGTAGAAGGGAGAAGG + Intronic
1094616328 12:32039436-32039458 GTTTTGGGGTAGAGGGAGTATGG + Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1095494226 12:42768061-42768083 GGGTTGTGGAAGAGGGAGGCTGG + Intergenic
1095600041 12:44003189-44003211 GGCTTGTGGCAGAGGGAACAAGG + Intronic
1096230287 12:49893030-49893052 GTAGTGGGGTGGAGGGAAGAGGG - Intronic
1096668809 12:53185534-53185556 GTTACATGGTAGAGGGAAGAAGG - Intronic
1096744358 12:53715778-53715800 GTGTGGAGGTAGAGGGATGGGGG - Exonic
1097980809 12:65736418-65736440 GGGGTGTGGGAGAGGGATGAGGG + Intergenic
1099201077 12:79677975-79677997 GTTTGGGGGTAGAGGGCAGATGG - Intronic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1099532494 12:83801453-83801475 GTGTCTAGTTAGAGGGAAGAAGG + Intergenic
1100024847 12:90115426-90115448 GTGTTGTGGTAGTCAGGAGAGGG - Intergenic
1100419454 12:94417390-94417412 CTTTTCTGGTAGAGGAAAGAGGG - Intronic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1102599328 12:114017278-114017300 GTGTTGTGGGAGGGGGAGGAGGG + Intergenic
1103618640 12:122171949-122171971 GAGTTGTGGCAGAGGGCAGATGG - Intronic
1104182891 12:126399476-126399498 GTGTGGTGGGTGAGGGATGAGGG - Intergenic
1104476579 12:129075341-129075363 GTGTTGTTATAAAAGGAAGATGG + Intronic
1104568710 12:129906849-129906871 GTATTGTCATAGAGAGAAGACGG - Intergenic
1104864481 12:131944732-131944754 GGGTTGGGGCAGAGGGCAGAAGG + Exonic
1105987063 13:25578109-25578131 GTGAGGTGGTAGAGAGAGGAGGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106764256 13:32897985-32898007 GAGTTGTGGTAGCTGGGAGAGGG - Intergenic
1109279765 13:60342368-60342390 GTATTGTGGTGGCTGGAAGAGGG - Intergenic
1109302661 13:60605194-60605216 TTGTTGTGTTAGAGAGAAGGTGG + Intergenic
1109593600 13:64520918-64520940 GTGTGGTGGTAAAGAGAAGTTGG - Intergenic
1110169994 13:72489008-72489030 GTTTTTTGGTGGGGGGAAGAGGG - Intergenic
1110301465 13:73933995-73934017 GTGTTGGGGGAGAGGGAAATAGG - Intronic
1111598478 13:90441498-90441520 ATGTTATGGTACATGGAAGAGGG + Intergenic
1111806514 13:93044989-93045011 GTGTTGGGGTGGAGAGATGAGGG - Intergenic
1111909625 13:94296080-94296102 GTGCTAGGGCAGAGGGAAGAGGG + Intronic
1111927878 13:94482477-94482499 GTAATGTGGTAGAGAGAAGGTGG - Intergenic
1113024001 13:105920654-105920676 GTGTTGGGGCAGAGGACAGAGGG - Intergenic
1113326763 13:109289743-109289765 ATGCTGTGGGAGAGGGAAGATGG + Intergenic
1113547625 13:111166372-111166394 GTGTTTGGGCAGAGGGGAGAAGG + Intronic
1118034869 14:61856025-61856047 GTGGTGTGGTTGAGGGATGGCGG + Intergenic
1118766173 14:68910725-68910747 GTGTTGTGGGAGAGAGACGGTGG + Intronic
1120747653 14:88166540-88166562 AAGTTCTGGTAGAGGGAAGTGGG - Intergenic
1121083496 14:91127498-91127520 GTGTTGGGGCAGAGGCCAGAAGG - Intronic
1122149207 14:99715741-99715763 GTGGTGGGGGAGAGGGGAGAGGG + Intronic
1124047013 15:26159864-26159886 GTGTTGTGGTAGAGTTCAGTGGG + Intergenic
1124077528 15:26460575-26460597 GTGTAGGGGTAGTGGGCAGATGG - Intergenic
1125056956 15:35371446-35371468 GTGTGGAGGTAGAGGGTATATGG + Exonic
1125267451 15:37899705-37899727 GTGGTTTGGTAGAGGGGACATGG - Intergenic
1126362533 15:47861223-47861245 CTGTTGTGGTAGGGGGCAGTGGG - Intergenic
1128161613 15:65426364-65426386 GTGATGGGGTACAGGGAAGAGGG + Intergenic
1128243005 15:66114264-66114286 TTGCTGTGGCAGAGAGAAGAGGG - Intronic
1128638343 15:69317478-69317500 GTGAACTGGCAGAGGGAAGAAGG - Intronic
1128867274 15:71123739-71123761 AGGTTGGGGGAGAGGGAAGAGGG + Intronic
1129072273 15:72961382-72961404 GTGTTGTGGGAGGGGGATGGAGG - Intergenic
1130071914 15:80654668-80654690 GTGCTAGGGTAGAGGGAAGGAGG - Intergenic
1131347115 15:91660531-91660553 GTGCTGTGCTAGATGGTAGATGG - Intergenic
1131779541 15:95841884-95841906 GTGGTGGGGTAGGGGGAGGAGGG - Intergenic
1131900065 15:97078117-97078139 GTGTTCTAGTAGATGGAAAAAGG + Intergenic
1134613738 16:15632551-15632573 GTGAGGTGGTAGAGAGAGGAGGG + Intronic
1135114757 16:19715139-19715161 GCGTTGTGGGACAGGGAAAATGG + Intronic
1135181075 16:20275131-20275153 GTGCTGTGGTGGAGAGATGATGG + Intergenic
1135751311 16:25060685-25060707 TTGTTTTGGTAGAGGGAGAAAGG + Intergenic
1137504041 16:49035647-49035669 ATACTGGGGTAGAGGGAAGAGGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137832824 16:51560412-51560434 GTATTGTGGAGGAGGGAAAATGG + Intergenic
1138578465 16:57923822-57923844 GTGGTGTGATAGAGAGTAGAGGG - Intronic
1138623472 16:58230619-58230641 GTGTTGTGGTAGTGGGTGGGTGG - Intergenic
1139738856 16:69017529-69017551 CTGTTGTGGTTAAAGGAAGAAGG - Intronic
1140146362 16:72314261-72314283 GTGTTGTGTTTGAAGTAAGATGG + Intergenic
1140244871 16:73238972-73238994 ATGCTGTGGGAGAGGGAAGCAGG - Intergenic
1141776614 16:86127374-86127396 GTGTTGGCGGAGAGGGAAGGGGG + Intergenic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1144557382 17:16294284-16294306 GTGATGTGGCAGAGAGAACATGG - Intronic
1145276646 17:21435409-21435431 GTCTTGTGGTGGGGGGAAGGTGG - Intergenic
1145314486 17:21721297-21721319 GTCTTGTGGTGGGGGGAAGGTGG - Intergenic
1145712941 17:26993274-26993296 GTCTTGTGGTTGGGGGAAGGTGG - Intergenic
1146580025 17:34029068-34029090 GTGTTGTGGGGGAGGTAGGAGGG - Intronic
1147534574 17:41311246-41311268 GTGTTGTGAAAGAGGGATGCAGG + Intergenic
1147538998 17:41341028-41341050 GTGCTGTGTTAGGAGGAAGATGG - Intergenic
1148001379 17:44389470-44389492 AGGTTGTGGAAGAAGGAAGATGG - Exonic
1148878033 17:50704134-50704156 TTGAGGTGGTAGAGGGATGAGGG + Intronic
1149718112 17:58814202-58814224 GTATTTTGTTAGATGGAAGATGG + Intronic
1150462424 17:65363910-65363932 GTGGTGGGGGAGAGGGAGGAGGG - Intergenic
1150500124 17:65643002-65643024 GTGTGGTGGAAGAGGGGATAAGG - Intronic
1151047023 17:70932811-70932833 GTGTTTTGGCAGAGGAAATACGG + Intergenic
1151149077 17:72068265-72068287 GTGTTGTGGGATCTGGAAGAGGG - Intergenic
1151630735 17:75309252-75309274 GTTTTGTGGCAGTGGGGAGAGGG + Intergenic
1152315493 17:79578110-79578132 GGGTAGTGGTGGAGGGAAGGGGG + Intergenic
1152471780 17:80493552-80493574 GTGCTGCGGGAGAGGGAAGGGGG - Intergenic
1152496706 17:80678134-80678156 GCCTTGTGGTAGTGGGGAGATGG - Intronic
1153445533 18:5168409-5168431 GTATTGTAGAAGAGGAAAGATGG + Intronic
1153530266 18:6039022-6039044 GGGTTGGGGAAGAGGGAGGAAGG - Intronic
1155373841 18:25134826-25134848 TTTTTGTGGTAGCTGGAAGATGG - Intronic
1155497187 18:26454289-26454311 GTGTTATGGTAGACTGAAGTTGG + Intergenic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1157571129 18:48713126-48713148 GGTTCCTGGTAGAGGGAAGAAGG + Intronic
1157798439 18:50598092-50598114 GTGTTGTGGTAGTGGTTGGAGGG - Intronic
1158233594 18:55287172-55287194 GCATTCTGGTAGACGGAAGATGG - Intronic
1158702633 18:59762403-59762425 GTGTTGGGGCAGGGGGAATATGG + Intergenic
1158720663 18:59921520-59921542 GTGGTGGGGGTGAGGGAAGATGG + Intergenic
1158830479 18:61272101-61272123 GTGTTGAGGTATAGGGATGGAGG - Intergenic
1159411054 18:68074662-68074684 GTTTTGTGGGAGAGGTGAGATGG - Intergenic
1159919664 18:74216102-74216124 ATGTTCTGGCAGAGGGAAGGTGG - Intergenic
1165115019 19:33523383-33523405 GTGTTGTGGGAAGGGGTAGAAGG - Intergenic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
1165994116 19:39832777-39832799 CTGTTGTGGTAGGGGGAATTGGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
924996828 2:368923-368945 GTGTGGTGGTACTGGGAAGTGGG - Intergenic
926031507 2:9594393-9594415 GGGTTGTGGTGGAAGGAGGAGGG + Intronic
926369170 2:12163113-12163135 GGGGTGGGGGAGAGGGAAGAAGG + Intergenic
926572193 2:14541885-14541907 GTGTTGTGGGAAAGGGAAGGGGG + Intergenic
926904351 2:17792148-17792170 TGGTTGTGGTAGGGGCAAGATGG + Intronic
927991130 2:27447921-27447943 TTCTAGAGGTAGAGGGAAGAAGG + Exonic
928494334 2:31816611-31816633 TTGCTGTGGTAGAGAGATGAAGG + Intergenic
929837468 2:45418711-45418733 GAGTTGTGCAAGAGGAAAGAAGG + Intronic
931355971 2:61537988-61538010 GTGTTTTGGTAGGGGGGAGTCGG - Exonic
932656059 2:73611998-73612020 GTGGTGTTGGAGAGGGGAGAGGG + Intergenic
933935772 2:87202720-87202742 TTGTTGTGGGAGGGGGAAGGCGG + Intergenic
936004460 2:108870803-108870825 GTGTTGGGGAAGAGGGAAATGGG + Intronic
936357376 2:111763110-111763132 TTGTTGTGGGAGGGGGAAGGCGG - Intergenic
937087501 2:119181196-119181218 GTGTTGTGGGGGTGGGAATATGG - Intergenic
937855954 2:126672117-126672139 GTGAGGTGGTAGAGAGATGAGGG + Intronic
938060814 2:128252874-128252896 AGATTGTGGCAGAGGGAAGATGG + Intronic
945997505 2:216450303-216450325 GTGTTGTTGTAGATGGCAGCTGG - Intronic
947197294 2:227581551-227581573 GTGTTGGGGAAGAGGGACCATGG + Intergenic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948762533 2:240201070-240201092 GTGGTGTGGGAAGGGGAAGATGG - Intergenic
1170914352 20:20608237-20608259 GTGTGTTGGTAGAGTGAAGTAGG - Intronic
1171062773 20:21982579-21982601 GTGCTGTGGTGCAGGGAAGTGGG - Intergenic
1172277826 20:33690024-33690046 GAGTTGTGGCAGAGGGAGGTGGG + Intergenic
1172654613 20:36529210-36529232 GTGTTCTGGTAGAGACCAGAAGG + Intergenic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1175843612 20:62047493-62047515 GTCTCGCTGTAGAGGGAAGAGGG - Intronic
1175934568 20:62509107-62509129 GTGTTGGGGTGGAGGGTTGAGGG - Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176233462 20:64043022-64043044 GGGTTGTGGGAGAGGGAGCAGGG + Intronic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1179034584 21:37748525-37748547 GTTTTGTGGTAGTGGGAATGTGG + Intronic
1179098257 21:38334914-38334936 GTGGTGTGGCAGAGGGGACAGGG - Intergenic
1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG + Intergenic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1181964265 22:26645549-26645571 GTGGTGGGGTAGAGGGATGGTGG + Intergenic
1182794530 22:32981177-32981199 GGTGTGTGGTAGAGGGGAGATGG + Intronic
1183068793 22:35381875-35381897 GTGTTGTAGAACAGGGAAGCAGG + Intronic
1183090137 22:35516739-35516761 GTGTTGTGGGAGTGGGCAGGGGG - Intergenic
1183214126 22:36468143-36468165 GTCTTGTGGTTAAGGGAGGAAGG - Intronic
1183592262 22:38786684-38786706 GGGTAGTGGGAGAGGGAATAAGG - Intronic
1184044695 22:41965603-41965625 GTCATGTGGCAGAGGGAAGGAGG - Intergenic
1184992109 22:48177697-48177719 ATGTTGTTGTTGAGGGATGAAGG - Intergenic
949433320 3:4002071-4002093 GTGGTGTAGTAAAGGGAGGAAGG + Intronic
949539142 3:5018617-5018639 GTGTTCTAGTAGAGGGGTGAAGG + Intergenic
949652146 3:6172067-6172089 GTGTAGAGGTAGGGGTAAGATGG - Intergenic
950352441 3:12369594-12369616 GTGTTTTGGAAAAGGGAATATGG - Intronic
950622229 3:14215175-14215197 GATTTGGGGTAGATGGAAGATGG + Intergenic
950947233 3:16961759-16961781 GAGTTGTGGGATAGGGAGGAAGG + Intronic
951354135 3:21643415-21643437 GTGTTAGGGTAGAGTGAAGATGG - Intronic
951825636 3:26865302-26865324 GTGTTGTGTAGGAAGGAAGAAGG - Intergenic
951938367 3:28049565-28049587 GTGGTGGGGGAGAGGCAAGATGG - Intergenic
953096584 3:39782751-39782773 GTACTGTAGTAGAGGGATGAGGG - Intergenic
953159961 3:40409584-40409606 GGTTTGTGGTAGTTGGAAGATGG + Intronic
953830421 3:46293377-46293399 ATGTTGTTGTAGGGGGTAGAGGG - Intergenic
954304117 3:49716594-49716616 GTTTTGAGGCAGAGGGAAGGTGG + Intronic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
955104593 3:55885068-55885090 GTGTGATGTTAGAGGGAAGAGGG - Intronic
955193894 3:56787223-56787245 ATGTTGGGGCAGAGGGAAGGAGG - Intronic
955373903 3:58378041-58378063 GTTTTTTGCTAGAGGGAGGAGGG - Intronic
956313563 3:67909060-67909082 GTCTCATGGTAGAGGGAAAAGGG - Intergenic
956455366 3:69415468-69415490 GTAGTGTGTTAGAGGGCAGAGGG - Intronic
956821449 3:72957862-72957884 TTGGTGGGGTAGAGGGAAAAAGG + Intronic
956938464 3:74131096-74131118 GTGTTGTGGAAGAGACACGATGG - Intergenic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
958693890 3:97503481-97503503 GTGTTTTGGTGCAGGGTAGAAGG - Intronic
960920253 3:122739372-122739394 GTGTTGTCACAGAGGGAAGGAGG - Intergenic
961522603 3:127475633-127475655 GTGGAGTGGGTGAGGGAAGAAGG - Intergenic
962465319 3:135652065-135652087 GTTCTGTGGGAGAGTGAAGAAGG - Intergenic
963038846 3:141053947-141053969 GTGTTGGAGTAAAAGGAAGAAGG - Intronic
963544532 3:146639236-146639258 GACTTGTTGTAGAGAGAAGAGGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964194734 3:154049492-154049514 GTGTTGTGGGAGCGGGTGGAGGG + Intergenic
964401398 3:156303050-156303072 GTGTTGTGGAGGAGAAAAGAAGG + Intronic
964824257 3:160808329-160808351 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
964824267 3:160808419-160808441 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
966884613 3:184369752-184369774 TTTTTGTGTTAGTGGGAAGAAGG + Intronic
967251679 3:187546577-187546599 GTGCAGTGGGAGAGGCAAGAAGG - Intergenic
968006783 3:195248467-195248489 GTGTTGTTGTTCAGGGAAGCGGG - Intronic
968698445 4:2043601-2043623 GTGGTGTGGGAGCTGGAAGAAGG + Intronic
968744447 4:2352424-2352446 GAGGCGTGGAAGAGGGAAGAAGG + Intronic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969324382 4:6432458-6432480 GTGCTGGAGTAGAGGGGAGAGGG - Intronic
970606984 4:17690284-17690306 GTGTAGTGGTAGAGGGCGGGTGG + Intronic
971167449 4:24198697-24198719 GAGTTGTGGTTCAGGGAAGCTGG + Intergenic
972355043 4:38272610-38272632 GTGTGGGGGTAGAGGGCATATGG - Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972913652 4:43849306-43849328 GGGTTGGGGTAGGGGGAATATGG - Intergenic
973068339 4:45825066-45825088 GTGTTGGGGTGGAGGGAGGGGGG + Intergenic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
973663262 4:53130575-53130597 GTGTAGAGGGAGAGGGGAGATGG - Intronic
974714010 4:65642315-65642337 GTGTGATGGTGCAGGGAAGAAGG + Intronic
974826280 4:67134746-67134768 TTGTTGTAGTACAGGGAAAAAGG - Intergenic
974828699 4:67162453-67162475 GGGTTGTGGTAGAGTGACTATGG - Intergenic
975783288 4:77862018-77862040 GTGTTGTGGGGGAGGTAAGCTGG + Intergenic
976720284 4:88162843-88162865 GTCCTGTGGTGGAGGGCAGAGGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
976936867 4:90646947-90646969 GTGTTGGGGTGGGGGGATGAGGG - Intronic
977723860 4:100271362-100271384 CTCTTGTGGTGGAGGAAAGAGGG + Intergenic
978066130 4:104405105-104405127 GTGTTGAGGTGGTGGTAAGATGG + Intergenic
979392754 4:120146003-120146025 ATGTTGGGGCAGTGGGAAGAAGG - Intergenic
979434736 4:120674532-120674554 GTGGTGTGCCAGAGGGAATAAGG - Intergenic
979453070 4:120895514-120895536 TTGATGTGGAAGAGGGAGGAAGG - Intronic
979846239 4:125516185-125516207 GTGTTGTGTCACAGGGAATAGGG + Intergenic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
982794702 4:159630611-159630633 GTGTTGAGTTGGAGGGAGGAAGG + Intergenic
983319714 4:166180402-166180424 ATGTTTTGGTAGAAGGAAGGAGG + Intergenic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
986179704 5:5382304-5382326 GTGTTGGGGGAGAAGGGAGAGGG + Intergenic
986822007 5:11477716-11477738 GTTTTGTGGTAGGGTCAAGATGG - Intronic
986898795 5:12406008-12406030 GTGTGAGGGTAGGGGGAAGATGG - Intergenic
987261071 5:16204008-16204030 TGGGTGTGGGAGAGGGAAGAGGG + Intergenic
987698866 5:21368366-21368388 GTGGTGGGGTAGAGGGAGGGGGG + Intergenic
988250371 5:28749486-28749508 GTTTTCTGGTATAGGGAATAAGG - Intergenic
988628966 5:32908755-32908777 GTGGTCTGGTAGAGGGATCATGG + Intergenic
988629916 5:32917779-32917801 GGGTTGTGGTGGAGGGATGGTGG + Intergenic
989141894 5:38209671-38209693 GGGCTGTGGGAGAGGGGAGAGGG + Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
990672627 5:58150030-58150052 GTGATGTGATATGGGGAAGAGGG + Intergenic
990742788 5:58929319-58929341 TTTCTGTGGTAGAGGGAAGTTGG - Intergenic
990944077 5:61231661-61231683 GTGTTGTGGTGGATGAAAGATGG + Intergenic
991338453 5:65577788-65577810 GTGTTGGGGCAGAGGGTATATGG - Intronic
991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG + Intergenic
992494291 5:77277128-77277150 GTGCTGTGGTAGAACGCAGAAGG + Intronic
994193573 5:96897011-96897033 GTGTGGTGTTAGAGGAAAAAGGG - Intronic
994919962 5:106031286-106031308 GTGTTGTGGGAGAGACCAGAGGG - Intergenic
995700753 5:114932470-114932492 TTGTTATGGTAAAGGGAAGGTGG - Intergenic
995812894 5:116127772-116127794 GTCTTGTGGTGGGGGGAAGGAGG + Intronic
996478043 5:123943057-123943079 CTGTTATGGTACAGGGAAAAGGG - Intergenic
996766552 5:127040210-127040232 GTGATGAGGTAGATAGAAGATGG + Intergenic
996819860 5:127614543-127614565 GTTTTGGGGTAGGGGGAAGGGGG + Intergenic
996837472 5:127809750-127809772 GTAATGTAGAAGAGGGAAGATGG + Intergenic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
999374875 5:151080040-151080062 GTGTTTTGGTAGGGGGAGGGAGG - Intronic
1000312591 5:160059611-160059633 TTGTTGTGGCTTAGGGAAGAGGG + Intronic
1000706645 5:164521057-164521079 GTGGTGAGGTACAGGGAGGATGG - Intergenic
1000829190 5:166082343-166082365 GTCTTATGGAAGAGGGAAGATGG - Intergenic
1001333714 5:170780969-170780991 GTGTTGAGGGTGGGGGAAGAAGG + Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002347163 5:178556032-178556054 GTGCTGTGATGGAGGGAAGAAGG - Intronic
1002881732 6:1258373-1258395 TTGTTGTGTTTCAGGGAAGAGGG - Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1007627128 6:43252982-43253004 GTCGTGTGGTAGAGGGAAAAGGG + Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1007973945 6:46081272-46081294 GTGGTGTGGCAAAGGGAAGCAGG - Intergenic
1009346961 6:62625128-62625150 GTCTTATGGCAGAGGTAAGAAGG - Intergenic
1009883348 6:69596600-69596622 GTGTGGTGGTAGTGGGAGGTGGG - Intergenic
1009915886 6:69995267-69995289 ATTTTGTGGTAGAGGGATAAAGG - Intronic
1010301705 6:74267975-74267997 GTGTGGTAGAACAGGGAAGATGG + Intergenic
1011176098 6:84562172-84562194 GTGTGGTGGTAGAGAGTAGAAGG + Intergenic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1011496038 6:87937341-87937363 GTGTTGGGGAAGAGGGATGCTGG + Intergenic
1011833329 6:91401072-91401094 CTGTTGTGGGAGAGGGGAGAGGG - Intergenic
1012217644 6:96607579-96607601 GTGTTTTGGTAGAGTAATGAAGG - Intronic
1012450855 6:99350978-99351000 GTGCTCTGGAAGAGGGAACAAGG + Intergenic
1012463986 6:99496830-99496852 GTGTTGGGGTAGGGGGGATATGG - Intronic
1013306731 6:108854640-108854662 GTGTTGTGGTAGGGGGTACATGG - Intronic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014047238 6:116904669-116904691 GGGACATGGTAGAGGGAAGATGG - Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1015015641 6:128409685-128409707 GTGTTGTGGGAGGGGGCCGATGG + Intronic
1015685319 6:135852422-135852444 GGTTTGTGGAACAGGGAAGAAGG + Intronic
1017192531 6:151669275-151669297 GTGTTGGGGGAGTGGGGAGAGGG + Intronic
1017390155 6:153929427-153929449 GAGGGGTGGTAGAGGGAGGAGGG - Intergenic
1018067738 6:160135415-160135437 TTATTGTGGTGGAGGGAAGAGGG + Intronic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1019011339 6:168845952-168845974 GTGTTGTGGGAGGGAGAAGGTGG - Intergenic
1019039701 6:169093698-169093720 GTGTTGTTGTGAAGGGCAGATGG - Intergenic
1019731024 7:2629728-2629750 GAGTTGTGGTGGGGGGAAGCAGG + Intergenic
1020045667 7:5038294-5038316 GTCTGGTGGGAGAGGGAACAGGG + Intronic
1020291068 7:6722493-6722515 GTCTGGTGGGAGAGGGAACAGGG + Intergenic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1022248822 7:28586636-28586658 GTGGTGTGATAGAGAGAAGTGGG + Intronic
1022509352 7:30925359-30925381 GAGTTGTGATGGAGGGGAGAGGG + Exonic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1023090538 7:36614084-36614106 GTTTTCTGGGAGAGGGAAGAGGG + Intronic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1023471375 7:40524881-40524903 GTGGTGTGGTAGAGAGTGGAGGG + Intronic
1024211061 7:47204898-47204920 TTTTTGTGGTAGAGGGTATAGGG - Intergenic
1026451777 7:70535799-70535821 GTCTTTTGGTGGAGGAAAGAAGG - Intronic
1026656438 7:72260775-72260797 GTGCTGTGGTGGGGGGAAGTGGG - Intronic
1027771968 7:82418276-82418298 GTGTTGTGGTAGGGGGGACCAGG - Intronic
1028164680 7:87524580-87524602 GTTGTGGGGTAGAGGGAAGGGGG + Intronic
1028354886 7:89894999-89895021 GTGGAGTGGTAAAGGGAACATGG - Intergenic
1028740717 7:94271258-94271280 CTGTTGTGGGTGAGGGGAGAGGG + Intergenic
1028836972 7:95385199-95385221 GTTGTGGGGTAGGGGGAAGAGGG + Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030095391 7:105894335-105894357 GTCCTGTGGTAGAGGGAACCTGG + Intronic
1031135755 7:117882429-117882451 GTGCTGGGGCAGAGGGAAGTGGG + Intergenic
1031634548 7:124086040-124086062 ATGTTGTGGGAGGGAGAAGATGG + Intergenic
1032238653 7:130144328-130144350 GGGTTGGGGGAGAGGAAAGAGGG + Intergenic
1032430121 7:131854115-131854137 TTTTTGTGGTAGGGGGAGGAAGG + Intergenic
1033195955 7:139327496-139327518 GTGTTGTGTCAGAAGGCAGAAGG + Intergenic
1033409584 7:141105095-141105117 GTGAGGTGGGAGAGGAAAGAGGG + Intronic
1033415814 7:141160458-141160480 GGGATGTGGCAGAGGGAAGGAGG - Intronic
1034422311 7:150996261-150996283 GGGATGGGGGAGAGGGAAGAAGG - Intronic
1034582321 7:152055968-152055990 GGGTTGTGGAAGGGGGAAGATGG - Intronic
1034730804 7:153386039-153386061 GGGCTGTGGGAGAGAGAAGAGGG + Intergenic
1035916122 8:3625426-3625448 ATGTAGTGGGAGAGGAAAGAGGG - Intronic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1037581507 8:20248498-20248520 GTCTTGAGGTGGAGGGAGGATGG + Exonic
1037696545 8:21228782-21228804 GTGGAGTGGGAGAGGGAAGCAGG + Intergenic
1037889884 8:22618499-22618521 GTGCTGGGGCAGAGGAAAGAAGG - Intronic
1038180696 8:25224613-25224635 TAGTTATGGTTGAGGGAAGATGG + Intronic
1038767609 8:30443499-30443521 GGGTTGTGGTAGGGGGAATTGGG + Intronic
1039127625 8:34220911-34220933 GTTTTGGGGTAGGGGGAAGGGGG + Intergenic
1039247728 8:35627988-35628010 GGGGTGTGGTTGAGGGAACAAGG + Intronic
1039713279 8:40080973-40080995 GTGCTGTCTTAGAAGGAAGAGGG + Intergenic
1040028256 8:42801357-42801379 GTGAGGTGGTAAAGGCAAGATGG + Intergenic
1041373542 8:57189904-57189926 GTCTTGTGAAAGAGGGATGAAGG - Intergenic
1041902282 8:62995582-62995604 GATATGTGGTAGAAGGAAGATGG + Intronic
1042153175 8:65811725-65811747 GTGTGTAGTTAGAGGGAAGAAGG + Intronic
1042965583 8:74348478-74348500 GTGTTGTGTTTGAGGGACCAGGG + Intronic
1043606602 8:82008178-82008200 GTTTTGTGGTAGCAGGAAGAGGG + Intergenic
1044131735 8:88532208-88532230 GTTGTGGGGTAGGGGGAAGAGGG - Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047347464 8:124042078-124042100 GTGTTGTGGCAGGTGGAGGAGGG - Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048475751 8:134740988-134741010 TGGTTATGGTAGAGGGAAAAGGG - Intergenic
1048527341 8:135215086-135215108 GAGGTGTGGTAGAGGGAATGTGG - Intergenic
1048664962 8:136650733-136650755 GAGATGTGGTTGAGGGAGGACGG - Intergenic
1049332014 8:142059639-142059661 GTGGTGGGGTAGAGGGAATTGGG - Intergenic
1050999354 9:12261079-12261101 GTGTTGTGGGAGAGTGGAGGAGG - Intergenic
1051288160 9:15517360-15517382 GTGTGGGGGTAGAGGGCATATGG - Intergenic
1052826348 9:33178443-33178465 GTGTTGTGACAGATTGAAGATGG - Intergenic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053654045 9:40197552-40197574 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053904433 9:42826729-42826751 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054366160 9:64343768-64343790 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054530552 9:66178785-66178807 GTGTTTGGGTAGATGGAGGAGGG - Intergenic
1054673789 9:67833498-67833520 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1056821680 9:89846486-89846508 GTGGTGAGGTAGTGGGAAGAAGG + Intergenic
1057242157 9:93420765-93420787 GTGTGGTGGCAGAGGACAGATGG - Intergenic
1057379594 9:94555783-94555805 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1057399903 9:94714120-94714142 GGGATGTGGGAGAGGGAAGGAGG + Intergenic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058557875 9:106189564-106189586 GTGGGGTGGTAGGGGGAAGTGGG - Intergenic
1058948405 9:109880386-109880408 GTGTTGATCTAGAGGGAAGTAGG + Intronic
1061218393 9:129235134-129235156 GTGCAATGGGAGAGGGAAGAAGG - Intergenic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061504694 9:131025310-131025332 TGGCTGTGGTAGAGGGAAGGGGG - Intronic
1062729287 9:138100177-138100199 GAGGTGGGGCAGAGGGAAGAGGG + Intronic
1185867876 X:3639321-3639343 GTGGGGTGGTAGATGGATGAAGG + Intronic
1185867893 X:3639367-3639389 GTGGGGTGGTAGATGGATGAAGG + Intronic
1186130464 X:6460116-6460138 GTGGGGGGGTAGAGGGTAGATGG + Intergenic
1186812128 X:13200688-13200710 GAGTTGGGGTAGACGGAATAGGG - Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1190056278 X:47182695-47182717 GTTTTGTGGGAGTGGGCAGATGG + Intronic
1190237505 X:48628311-48628333 GGGTGGAGGGAGAGGGAAGAAGG + Intergenic
1192333474 X:70199127-70199149 GGGTTGGGGAAGAGGGGAGAAGG + Intronic
1192500314 X:71645862-71645884 GGGGTGTGGGAGAGGGAGGAGGG + Intergenic
1192790155 X:74373655-74373677 TGGCTGTGGTAGGGGGAAGAGGG + Intergenic
1193316418 X:80071057-80071079 GTGTTGTGGGAGAGACCAGATGG - Intergenic
1193418828 X:81258595-81258617 GTGTTTTGGTTGAGAGAAGTGGG + Intronic
1194184491 X:90757060-90757082 GTGTTGCAGTGGAAGGAAGAGGG + Intergenic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195939674 X:110157657-110157679 GTGCTGTGGGAAATGGAAGAAGG + Intronic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1197137163 X:123074894-123074916 GTGGTGTGGTAAAAGGAACATGG - Intergenic
1197806041 X:130399454-130399476 GTGGTGTGGTGGTGGGAAGTTGG + Intergenic
1197894189 X:131293109-131293131 GTGTTGTGGTGGGGGGATGGGGG + Intronic
1198056647 X:133002297-133002319 GTGGTGTGGCATAGAGAAGAGGG + Intergenic
1198494102 X:137173402-137173424 ATGTTGGGGTAGGGGAAAGAGGG - Intergenic
1199779802 X:151047882-151047904 CTCATGTGGTAGAGGGCAGATGG - Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1201560977 Y:15316411-15316433 GTGTTGAGGTAGGGGGCTGAGGG - Intergenic
1202093407 Y:21217592-21217614 GGGGAGTGGGAGAGGGAAGAGGG + Intergenic