ID: 1099420383

View in Genome Browser
Species Human (GRCh38)
Location 12:82451056-82451078
Sequence GGTTCTTTGGTTCTATTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099420383_1099420387 14 Left 1099420383 12:82451056-82451078 CCAAGTAATAGAACCAAAGAACC 0: 1
1: 0
2: 1
3: 8
4: 181
Right 1099420387 12:82451093-82451115 TTTAGAAAAGCTTTTGAAAGAGG 0: 1
1: 0
2: 2
3: 48
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099420383 Original CRISPR GGTTCTTTGGTTCTATTACT TGG (reversed) Intronic
900738870 1:4318259-4318281 GAATCTTTTGTTCTATTATTTGG - Intergenic
904302792 1:29566231-29566253 GGTTCTTTCTTTCTGTTTCTGGG - Intergenic
911207684 1:95108781-95108803 GCTTATTTGGGTCTATTTCTGGG + Intergenic
911836071 1:102620636-102620658 GGTTCTCTAGTTCTTTTAGTGGG + Intergenic
912164025 1:107020884-107020906 AATTCTTTTGTCCTATTACTCGG + Intergenic
913395136 1:118361164-118361186 AGTTCTTTGTTTTTATTGCTGGG - Intergenic
916290132 1:163156686-163156708 TGTTCTTTGATTCTGTCACTTGG - Intronic
916774770 1:167949844-167949866 GGGTTTTTGCTTCTATTTCTTGG + Intronic
917325584 1:173828431-173828453 GCTTCTTTGATGCTATTGCTGGG + Intronic
918711832 1:187740879-187740901 GGTTATTTTTTTCTATTTCTGGG - Intergenic
919223247 1:194659397-194659419 AGTTATTTGGTTATATTCCTGGG + Intergenic
920084160 1:203402507-203402529 TGTTCTTTTGTTCTTTTTCTTGG + Intergenic
921694141 1:218187571-218187593 AATGCTTTGGTTCTATTCCTTGG - Intergenic
1064411506 10:15108757-15108779 GGATCTTTTGTTCTGTTACATGG + Exonic
1065691816 10:28341782-28341804 GGTTATTTGTTTCTGTTTCTGGG + Intergenic
1067402373 10:45988515-45988537 AGGTCTTTTGTTGTATTACTGGG - Intronic
1067870723 10:49958148-49958170 AGGTCTTTTGTTGTATTACTGGG - Intronic
1069016978 10:63441252-63441274 TGTCCTTGGATTCTATTACTGGG + Intronic
1079008953 11:16812712-16812734 GGTTCTTTGGTTCTGTTGCTAGG - Intronic
1080556979 11:33426954-33426976 GGCTCTTTGGGGCTATTAATTGG + Intergenic
1081778158 11:45691180-45691202 GGCTCTGTGCTTCTATGACTTGG + Intergenic
1083023994 11:59534479-59534501 GGTTCTTTACTTCTCTTACATGG - Intergenic
1083082958 11:60112695-60112717 GGATCATTGGTTCTCATACTTGG - Intergenic
1083248341 11:61447951-61447973 CATTCTGTGGTTCTATTAATAGG - Intronic
1084632195 11:70360297-70360319 AATTCTTTACTTCTATTACTTGG - Intronic
1084991494 11:72929733-72929755 AGCTCTTTGGTTCTATTTTTGGG - Intronic
1088939828 11:114441906-114441928 GGTTGTTTTTTTCTGTTACTTGG + Intronic
1090219648 11:125007890-125007912 GGTCGTTTGGTTCTATACCTGGG + Intronic
1090336867 11:125974663-125974685 TGTTTTTAAGTTCTATTACTTGG + Intronic
1093089098 12:14901734-14901756 GTTTCCCTGGTTCTATTCCTTGG - Intronic
1094300946 12:28964814-28964836 GGTTCTTTGGTTTTGGAACTTGG - Intergenic
1095159201 12:38896588-38896610 TGTTCTTTTGTTCTAAAACTTGG + Intronic
1095629753 12:44361740-44361762 GATTCTTTGGTGCTGGTACTAGG + Intronic
1097395017 12:59062627-59062649 GTTTCTTTGTTTCTGTTCCTGGG + Intergenic
1099420383 12:82451056-82451078 GGTTCTTTGGTTCTATTACTTGG - Intronic
1099599431 12:84713896-84713918 GTTTCTCTTGTCCTATTACTTGG - Intergenic
1101621896 12:106396735-106396757 GGATCTTTGATTCTTTAACTTGG - Intronic
1109534547 13:63699420-63699442 GCTTGTTTGATTCTATTGCTGGG + Intergenic
1110889739 13:80683990-80684012 GGCTCTCTGGTTCTTTTTCTTGG + Intergenic
1110980837 13:81895606-81895628 GTTTCTTTACTTCTATTGCTTGG + Intergenic
1112188240 13:97148844-97148866 GGTTAATTAGTTCTATTCCTAGG + Intergenic
1113580787 13:111427204-111427226 GGTTCCTTTGTTCTTTTCCTTGG + Intergenic
1116428754 14:44821337-44821359 GGTTCTTTGCTTCTTTGAATTGG - Intergenic
1118679019 14:68220048-68220070 GCTTGTTTGATTCTATTGCTGGG - Intronic
1118952016 14:70443532-70443554 GGTTCTTCAGTTCTACAACTTGG - Intergenic
1119981095 14:79081949-79081971 AATTCTTTGGATCTATTATTTGG - Intronic
1125911854 15:43447202-43447224 GGTTCTGTGATTTTACTACTAGG - Intronic
1125928028 15:43579120-43579142 GCTTCTTTGTTTCTCTTTCTAGG - Exonic
1125941172 15:43678691-43678713 GCTTCTTTGTTTCTCTTTCTAGG - Intergenic
1126763780 15:51993280-51993302 GGATCTTTTGTTCTAATATTTGG - Intronic
1127622532 15:60747880-60747902 GCTTCTTTGTTTCTAGGACTTGG + Intronic
1130761692 15:86827528-86827550 GGTTATTTGGTTATTTTCCTGGG + Intronic
1133616438 16:7481004-7481026 GGTTCTTTGGCCATATCACTTGG - Intronic
1134215592 16:12314675-12314697 GGTTCTTTGATTCTACAGCTTGG + Intronic
1135142004 16:19929868-19929890 GGTTGTTTGGTTTGATTGCTTGG - Intergenic
1138455904 16:57120577-57120599 GAATCTTAGGTTCTAGTACTGGG + Intronic
1141459237 16:84167590-84167612 GGCTCTTTTGTTCTAATATTTGG - Intronic
1141539997 16:84712819-84712841 AGTTATTTGGTTTTATTCCTTGG + Intronic
1144114517 17:12074371-12074393 TGTTCTTTGGTTAAGTTACTTGG + Intronic
1144169733 17:12648243-12648265 GGTTCTTCTGTGCTATTTCTTGG + Intergenic
1144248079 17:13387360-13387382 GCATCTTTTGTTCTAATACTTGG - Intergenic
1146325636 17:31883648-31883670 AGTTCTTTGATTCACTTACTGGG - Intronic
1149242038 17:54662415-54662437 GGTTCTTTGATTCTTTTCATTGG + Intergenic
1153353920 18:4113921-4113943 AGCTCTGTGGCTCTATTACTAGG + Intronic
1153517513 18:5917807-5917829 GGATCTTTGCATCTGTTACTTGG + Intergenic
1153677740 18:7470471-7470493 GGTGCTCTGGTTCTAATAGTTGG + Intergenic
1154984185 18:21532934-21532956 GGTACTTTGCATATATTACTTGG - Intronic
1155560256 18:27068382-27068404 GGTTCTTTGTTTCTAGTTCTTGG + Intronic
1155714856 18:28928822-28928844 GGTTCTATTGCTATATTACTAGG - Intergenic
1157705669 18:49803704-49803726 GATTCTTTTATTCTAATACTAGG - Intronic
1158049718 18:53202156-53202178 GGTTTTCTGGTTCTTTTAGTGGG - Intronic
1158352922 18:56582086-56582108 GGTCATTTGGTTCTATCTCTTGG - Intergenic
1162283605 19:9720438-9720460 GGTACTTTGGTTTTATCATTGGG - Intergenic
1165020951 19:32923757-32923779 GGTTCTTTGCCTCTTGTACTTGG - Intronic
1165093252 19:33397381-33397403 GGTTCGTGGGTTCAATTCCTGGG - Intronic
1165284009 19:34823471-34823493 GGTGCTTTTCTTCTAATACTGGG + Intergenic
1168669161 19:58228413-58228435 GGGGCTTTGTTTCTATCACTAGG + Intergenic
925613524 2:5723831-5723853 TGTTCCTTGGTTCTCTTACCTGG - Intergenic
926160280 2:10482930-10482952 GAATCTTTGGTTCTAATATTCGG - Intergenic
926624000 2:15074803-15074825 GGTGCTTGAGATCTATTACTTGG - Intergenic
929177593 2:38996942-38996964 GGTTTCGTGGTTCTATTTCTAGG + Exonic
929845340 2:45520217-45520239 GGTACTTTTGTGCTGTTACTGGG + Intronic
929961782 2:46502641-46502663 GGATCCTTGCTTCTCTTACTGGG - Intronic
931052688 2:58431471-58431493 GGGTTTTTGGATCTATTACTTGG + Intergenic
931389354 2:61827715-61827737 GCTTCTCTGGTTATATTCCTAGG - Intronic
933901189 2:86851274-86851296 GGTTGTTTCTTTCTATCACTGGG + Intronic
934068163 2:88359301-88359323 GGTTTTTTGGTTTTATTTTTAGG - Intergenic
935743930 2:106174662-106174684 CGTGCCTTGGTTCTGTTACTAGG - Intronic
935779357 2:106497962-106497984 GGTTGTTTCTTTCTATCACTGGG - Intergenic
935929685 2:108110688-108110710 GGTTCTCTAGTTCTTTTAGTTGG + Intergenic
935958777 2:108403449-108403471 GCTACTTTGGTTTTATTATTGGG - Intergenic
936862572 2:117034992-117035014 GGTTCTCTACTTCTATTAGTTGG - Intergenic
937098180 2:119249161-119249183 TGTTCTTTGTTTGTTTTACTGGG + Intronic
937540802 2:122950321-122950343 GGTTCTTTGTTTTTTTTTCTTGG + Intergenic
939357952 2:141128278-141128300 TGTTGTTTTGTTCTGTTACTTGG - Intronic
939385574 2:141492506-141492528 TGTTCATTGGTTATTTTACTTGG + Intronic
939838457 2:147157431-147157453 GGTTGTCTGGTTGTATTGCTGGG - Intergenic
940474619 2:154147035-154147057 CATTCTTAGGTTCTATAACTGGG - Intronic
943495685 2:188618246-188618268 CGTTCTTTGTTTGTCTTACTAGG + Intergenic
945491952 2:210466455-210466477 GGTTCCTTTGTTCTTATACTAGG - Intronic
946717979 2:222573204-222573226 GGATCTTTGTTTATATTTCTGGG + Intronic
1170745176 20:19092655-19092677 GGTTCTATAGTGCTATTTCTGGG - Intergenic
1170901664 20:20469266-20469288 GGATCTTTGGTTCTTTTTCCTGG - Intronic
1172970254 20:38867975-38867997 GATTCTTTGATTCTATCAGTTGG + Intronic
1175130776 20:56787978-56788000 GGTTCTTTTGTGTTCTTACTTGG + Intergenic
1178364209 21:31975059-31975081 GGTTCTCTGGTCCTAAAACTCGG + Intronic
1185115345 22:48931633-48931655 GGTTCTTTGGTCCTCAGACTTGG - Intergenic
949832866 3:8235033-8235055 CATTCTTTGTTTCTATTACAAGG - Intergenic
952249374 3:31635325-31635347 GGTAATTTGTTTCTAATACTAGG + Intronic
953573053 3:44087782-44087804 GGATCTTTTGTTCTAATATTTGG - Intergenic
953728902 3:45428165-45428187 GGTTTTTTGGTTCTTTTTCTAGG + Intronic
955234297 3:57125936-57125958 GGTTCTTGGGGTATATTACTTGG - Intronic
955721636 3:61887974-61887996 TGTTTTTTGGTTTTTTTACTTGG - Intronic
957470432 3:80652395-80652417 GGTACTTAGGTTCTAATAATTGG - Intergenic
959055185 3:101560952-101560974 ATTTCTTTGGGTATATTACTAGG + Intergenic
959327918 3:104961266-104961288 GGTTCTTTGATTCTGTTAGAAGG - Intergenic
960105849 3:113796235-113796257 GCCTCTTTGTTTCTATAACTAGG - Intronic
960833229 3:121874231-121874253 CCTTCTTTAGTTCTATTATTAGG - Intronic
962895529 3:139710531-139710553 GGCTCTCTGGTTCTTTTGCTGGG + Intergenic
966750749 3:183319820-183319842 GGCTCTGTTGTTCTATTTCTAGG + Intronic
968250561 3:197207328-197207350 GATACTTTGGTTTTATTCCTGGG - Intronic
969841546 4:9886699-9886721 TGTTCTTTGGTTGTGTTTCTTGG - Intronic
969932888 4:10649378-10649400 AGTTCTTTGCTTCTCTTTCTAGG - Intronic
969997400 4:11326874-11326896 GTTTCTTTGGTTCCAGAACTGGG + Intergenic
971814474 4:31468480-31468502 GTTGCTTGGGTTTTATTACTTGG + Intergenic
972185980 4:36529149-36529171 GGTTCTTTGGCTTTGTTTCTGGG + Intergenic
972882295 4:43440143-43440165 AGTTCTTAGTTTCTATTATTGGG + Intergenic
976599350 4:86923980-86924002 TTTTCTTTGGTTCTTTTATTTGG + Intronic
976768524 4:88624112-88624134 GGTTTTTGTGTTTTATTACTGGG + Intronic
976768634 4:88626091-88626113 GTGTCTTTGGTTTTATTATTAGG + Intronic
977296745 4:95218379-95218401 TGTGCTTTTGTACTATTACTTGG - Intronic
980906512 4:138953423-138953445 GCTTCATTGCTTCTATAACTGGG + Intergenic
985108144 4:186519558-186519580 GCTTGTTTAATTCTATTACTGGG + Intronic
989238253 5:39174359-39174381 GGTTTTATGGTTCTATCTCTAGG - Intronic
990798249 5:59568833-59568855 GGTTCTTTTTTTCTATTCCAGGG - Intronic
994650677 5:102522953-102522975 GGTGCTTTGGTTGAAATACTTGG + Intergenic
995395204 5:111679980-111680002 GGTCATTTTGTTCTATTCCTTGG + Intronic
995672033 5:114616026-114616048 GGTTCTCTAGTTCTTTTACTTGG - Intergenic
1001879611 5:175232015-175232037 GCTTCTATGGTTCTCTTCCTGGG + Intergenic
1001945125 5:175772317-175772339 GGATCTTTGGTTCTGATATTTGG - Intergenic
1003252171 6:4439441-4439463 CATCCTTTGGTTCTATTTCTTGG - Intergenic
1005021031 6:21418933-21418955 AGTTCTTTGGGTCTGTAACTTGG - Intergenic
1011321615 6:86100556-86100578 GGTTCTTTTGATCTATTGCATGG + Intergenic
1011321816 6:86104017-86104039 GGTCCTTTGGCTCTAGTTCTAGG + Intergenic
1014697990 6:124648048-124648070 TGTTCTTTGTTTGTTTTACTTGG - Intronic
1017234405 6:152104682-152104704 GGCTCTTTTGTTCTAATATTTGG + Intronic
1027625469 7:80539380-80539402 GATTCTTTGCCCCTATTACTAGG + Intronic
1029029003 7:97449104-97449126 GAATCTTTTGTCCTATTACTTGG - Intergenic
1030260594 7:107560271-107560293 GCCTCTGTGGTTCTATTTCTTGG - Intronic
1031580813 7:123472613-123472635 GATTCTTTGATTGTATCACTCGG - Intronic
1032089638 7:128904732-128904754 AGTCCTTTGGGTCTCTTACTTGG - Intronic
1033641947 7:143269681-143269703 GGGACTTTGGGTCAATTACTGGG - Intronic
1037702287 8:21285993-21286015 GGTTCTTGGGATCTGTAACTAGG + Intergenic
1038374391 8:27023825-27023847 GGTATTTTGCTTCTTTTACTTGG - Intergenic
1038991747 8:32875716-32875738 TGGCCTTTGGTTCTACTACTTGG + Intergenic
1039636792 8:39176249-39176271 GGTTCTCTTGTTCTTTTAGTTGG + Intronic
1040677755 8:49771027-49771049 GGTGCCTGTGTTCTATTACTAGG - Intergenic
1043124320 8:76370177-76370199 GCTTTTGTTGTTCTATTACTGGG - Intergenic
1044805119 8:95999119-95999141 GTTTCTTTGTTTCTTTTGCTTGG - Intergenic
1045302716 8:100927921-100927943 GGTTCTTTTGGTCTATCATTAGG - Intronic
1046947338 8:119986945-119986967 GGTTCTTAGCTTCTTTCACTGGG + Intronic
1047533201 8:125695923-125695945 GGGGCTTTGGTTCTATAACCAGG + Intergenic
1048744861 8:137602910-137602932 GGGTTTTTGGTTTTATTATTAGG + Intergenic
1049004315 8:139845167-139845189 GGTTATATGGTTGTATGACTTGG + Intronic
1051502872 9:17797154-17797176 AGTTCTTTGGGTCTAACACTGGG + Intergenic
1051672697 9:19528091-19528113 CGTTCTTTGGCTCCATTACCTGG - Exonic
1052234674 9:26195741-26195763 GGTTCTCTGATACTATTTCTGGG + Intergenic
1052509300 9:29394350-29394372 GTTTCTTTGAGTCTATTTCTGGG - Intergenic
1056882589 9:90411835-90411857 GATCTTTTGGTTATATTACTAGG - Intergenic
1057612687 9:96560493-96560515 GGACATTTGGTCCTATTACTTGG - Intronic
1058212670 9:102189883-102189905 GGTTCTCTGTTTCTCTTGCTGGG + Intergenic
1058653587 9:107199577-107199599 GGTTCTTTGCTTCTAATAGAAGG - Intergenic
1059508654 9:114823297-114823319 GCTTCTTTGGTTCCATTAGATGG - Intergenic
1061376908 9:130231699-130231721 GGTTCTTTGGGTATATACCTAGG + Intronic
1186781216 X:12914080-12914102 TGTTATTTGGATCTATTTCTAGG - Intronic
1186950366 X:14617767-14617789 GATTCTTTGGTTCAACTATTTGG - Intronic
1187794682 X:22990273-22990295 GGTTGTTTCGGTCTATTTCTAGG + Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1188079480 X:25819029-25819051 GGCTCTTTGGTCATGTTACTAGG - Intergenic
1188775300 X:34209549-34209571 GGATCTCTAGTTCTTTTACTTGG + Intergenic
1191631129 X:63323324-63323346 TGTTCTCTGTTTCTATTACTTGG - Intergenic
1193271350 X:79533006-79533028 GGTTCATTAATTCTATTATTGGG - Intergenic
1196000522 X:110779509-110779531 GTTTATTTGGGTCTATTTCTGGG + Intronic
1196159705 X:112469439-112469461 GGAACTTTGTTTCTGTTACTAGG - Intergenic
1196978031 X:121181219-121181241 GGTTGTTTGGTTGTTTTTCTGGG + Intergenic
1197484060 X:127025133-127025155 GTTTTTTTGTTTCTATTACAAGG - Intergenic
1197490381 X:127109243-127109265 GGTTCTCTAGTTCTTTTAGTTGG - Intergenic
1199036561 X:143057577-143057599 GATTCTGTGATTCTATTACATGG + Intergenic
1199490655 X:148396744-148396766 AGTTGTTTGGGTCTATTTCTGGG + Intergenic
1200080517 X:153573968-153573990 CGTTCTTTGGTTCAATTCCTTGG + Intronic
1201465456 Y:14275536-14275558 GAATCTTTGGTTCTATGACTTGG - Intergenic