ID: 1099421789

View in Genome Browser
Species Human (GRCh38)
Location 12:82470889-82470911
Sequence CTACATGAACAGTTAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 2, 2: 1, 3: 7, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099421789 Original CRISPR CTACATGAACAGTTAAAGCT GGG Intronic
902057593 1:13615176-13615198 CTTCAACAACAGTCAAAGCTAGG - Intronic
903876205 1:26474858-26474880 CTACATGAAGTTTTCAAGCTAGG + Intronic
907922859 1:58929574-58929596 GTACATGAGTAGTCAAAGCTGGG + Intergenic
909323558 1:74320609-74320631 CAACATTAACAATTAAATCTTGG - Intronic
909481091 1:76129537-76129559 CTAAATCAACAGTTAAAGAAGGG - Intronic
910471438 1:87557480-87557502 CACCATGAACAGTCAAACCTAGG + Intergenic
910476135 1:87609413-87609435 TTACAGGAACAGTAAAGGCTGGG - Intergenic
911582237 1:99647180-99647202 TTACATCAAAAGTTATAGCTAGG - Intronic
912780174 1:112539130-112539152 CTATATATACATTTAAAGCTTGG - Intronic
920452438 1:206069837-206069859 TTACATGAATAGTAAAAACTTGG + Intronic
923794113 1:237136689-237136711 GTACATCAACAGTTATAGGTTGG + Intronic
1063170447 10:3505145-3505167 AAACTTGAACAGTTAAAGCATGG - Intergenic
1066521269 10:36222608-36222630 CTACATGATCATTCAAAGATGGG - Intergenic
1066720667 10:38334565-38334587 CTCCACCAAAAGTTAAAGCTTGG + Intergenic
1068241296 10:54304470-54304492 CAAAATGAACAGCAAAAGCTTGG + Intronic
1070432184 10:76351881-76351903 CTTCATCAACAGTAAAAGGTGGG + Intronic
1071717730 10:88114135-88114157 CTACTTGGAGAGTTAAAGTTTGG + Intergenic
1074456420 10:113599662-113599684 CTGCGTGAATAGTCAAAGCTGGG - Intronic
1075680581 10:124328412-124328434 CAGCATGAACAGTGAAAGCCTGG - Intergenic
1076588237 10:131564774-131564796 CTATATGGACAATTAAAGCATGG + Intergenic
1082218049 11:49598801-49598823 CAACATGAAAAGGTAAAGATAGG - Intergenic
1088654774 11:111988772-111988794 CTACCTGAGCAGTTAAGCCTGGG + Intronic
1088672860 11:112160363-112160385 CTAGAGGAACTATTAAAGCTGGG - Intronic
1097575288 12:61385151-61385173 CAACATGAAGAGTTAGAACTTGG + Intergenic
1098634768 12:72768696-72768718 CTTCATTAACAGTTAAAGTTTGG + Intergenic
1099421789 12:82470889-82470911 CTACATGAACAGTTAAAGCTGGG + Intronic
1099631529 12:85152508-85152530 CTACATGAAAAATTACATCTGGG - Intronic
1101117539 12:101546915-101546937 TTAAATGTACAGTTAAGGCTGGG - Intergenic
1101506108 12:105348044-105348066 TTACAGGAACTGTTAAAGATGGG + Intronic
1106012549 13:25838603-25838625 CAAAATGAACATTTAAAGCAGGG + Intronic
1106941524 13:34785686-34785708 GTACATGAATAGTTTTAGCTGGG - Intergenic
1111381865 13:87465383-87465405 CTATATGACAAGTTAAAGATTGG + Intergenic
1111724380 13:91986497-91986519 CTATATGAAAATGTAAAGCTGGG - Intronic
1112357197 13:98683569-98683591 ATAGATGAACAGATAAAGGTAGG - Intergenic
1116785709 14:49286276-49286298 ATACAAAAACAGTTAAAGGTAGG + Intergenic
1120405405 14:84088800-84088822 CTACATGAACAGTCAAGTGTGGG + Intergenic
1126083181 15:44985657-44985679 CTACTTGACCATTTAAAGTTAGG + Intergenic
1126447872 15:48770046-48770068 TTAAATGAACAGATAAATCTGGG - Intronic
1130876268 15:88017435-88017457 CTCCAGGAAAAGTGAAAGCTTGG + Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131357842 15:91761261-91761283 CTACAGGAAAAGGTAAAGTTGGG + Intergenic
1131996664 15:98139655-98139677 CTATATGACAAGTTAATGCTAGG - Intergenic
1136508039 16:30718771-30718793 CTACATCAAAATTTAAAACTGGG - Intronic
1139890878 16:70252640-70252662 CTACAAGAACATTTGAATCTTGG - Exonic
1140142675 16:72273416-72273438 CAAAATGAACAGTTAAAGTCTGG + Intergenic
1140806574 16:78537693-78537715 CTACATGAACTGTGGCAGCTGGG - Intronic
1141327225 16:83072674-83072696 CTCCATGCACAGATCAAGCTTGG - Intronic
1142033119 16:87848236-87848258 CTCCTTGAACAGTTACAGATTGG - Intronic
1146231511 17:31115080-31115102 CTACATCAACAGTCAAAGAAGGG - Intronic
1147664431 17:42137496-42137518 AATCATGAAAAGTTAAAGCTTGG + Intronic
1147977588 17:44256642-44256664 GTACATGCACAGTGAGAGCTGGG - Intronic
1149236907 17:54602255-54602277 ATACATGTACAATTATAGCTGGG - Intergenic
1149809126 17:59650367-59650389 CTAAATTAAAATTTAAAGCTAGG + Intronic
1150824188 17:68460202-68460224 CTACATGAACACTTAAAATGTGG - Intergenic
1151647346 17:75442257-75442279 TCACATGAAAAGTTAATGCTGGG - Intronic
1153638961 18:7138523-7138545 CAACATTAACAGTCACAGCTTGG - Intergenic
1155023038 18:21913946-21913968 CTATATGACTAGTTAAAGATAGG + Intergenic
1155729193 18:29130834-29130856 CTAAATGAACAATTAAGCCTTGG + Intergenic
1156236831 18:35213706-35213728 CTACATGAAAATTTAAAAATTGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159977024 18:74726656-74726678 CTACATGTGGAGTTAAAGCATGG + Intronic
1161215967 19:3095152-3095174 CAACATGAACAGTTAAGGCAGGG - Intronic
1161965829 19:7548048-7548070 ATACACTAACAGTTATAGCTGGG + Intronic
1164322338 19:24160631-24160653 CTACATGAACAGTTAAGGCTGGG - Intergenic
925808059 2:7672071-7672093 CTCCATAAACAGGTAAATCTTGG - Intergenic
926002627 2:9346055-9346077 TCACATGACCAGTGAAAGCTGGG - Intronic
928852304 2:35763697-35763719 CCACATGAACTGTTAAAGGAAGG + Intergenic
929131168 2:38573814-38573836 TTACATGTACAGTGAAATCTGGG + Intronic
932570982 2:72938315-72938337 CTACAGGAACAATTAAATTTTGG + Intergenic
933527283 2:83457620-83457642 CTGAATGAACAGTTAAAAATGGG + Intergenic
936140030 2:109931577-109931599 TTAAATGAGCAGTTAAGGCTAGG - Intergenic
936176719 2:110229522-110229544 TTAAATGAGCAGTTAAGGCTAGG - Intergenic
936204666 2:110439909-110439931 TTAAATGAGCAGTTAAGGCTAGG + Intronic
938744339 2:134262761-134262783 CTACATGAACAGTTATGCCTGGG - Intronic
938765674 2:134459412-134459434 TTACAGGAACAGTTACAGGTGGG - Intronic
945545805 2:211149815-211149837 CTACAAGAACAATTGAAGCATGG + Intergenic
946465809 2:219910969-219910991 ATACATGAATAATTAAAGCAGGG + Intergenic
947135198 2:226970445-226970467 CTTCATGTACAGATAAAACTTGG - Intronic
947473542 2:230419995-230420017 CTAAATGAACAGATAAATTTAGG + Intronic
1169711726 20:8571808-8571830 CTTTATGGACATTTAAAGCTCGG + Intronic
1182180607 22:28343825-28343847 TTACATGAATAGTAAAAACTTGG + Intronic
1183271466 22:36865163-36865185 CTACATGAACAGTTTTCACTGGG - Intronic
951645416 3:24885190-24885212 CTACTTGAACATTTAAGGCCAGG - Intergenic
955993851 3:64657669-64657691 CTACATGAAAATTTAAAATTAGG + Intronic
956605745 3:71071301-71071323 CTACATGAACCGTCAAAGACTGG - Intronic
959262193 3:104096907-104096929 ATATATTAACAGTTAAATCTGGG - Intergenic
967488026 3:190056901-190056923 CTACTTGAACAGTTGAGGCTTGG - Intronic
970937231 4:21587502-21587524 GTAAATGAAGAGTTAGAGCTTGG + Intronic
971195363 4:24468244-24468266 CAACATCAAAAGATAAAGCTCGG + Intergenic
972516869 4:39817250-39817272 CTATATGAACTGTAAAATCTAGG + Intergenic
972836886 4:42882043-42882065 GTACAGAAACAGTTAAAGATAGG - Intergenic
973882859 4:55291287-55291309 CTACATAAACAATGACAGCTGGG - Intergenic
974926975 4:68311239-68311261 CTACATGGACAATGGAAGCTTGG + Exonic
975698239 4:77035896-77035918 CTACATGTAGAGAGAAAGCTGGG - Exonic
980393360 4:132174780-132174802 CTACATGAACATTTGAAGGTAGG + Intergenic
980458988 4:133080686-133080708 CTGAATAAACAGTTAAACCTAGG - Intergenic
981355926 4:143789136-143789158 CTACAGAAAAAATTAAAGCTGGG - Intergenic
981367463 4:143919793-143919815 CTACAGAAAAAATTAAAGCTGGG - Intergenic
981377253 4:144030027-144030049 CTACAGAAAAAATTAAAGCTGGG - Intergenic
982058694 4:151580314-151580336 CTACATGCCCAGTTAAATTTAGG + Intronic
982976251 4:162065948-162065970 ATACAAGAAAAGTTAAAGCATGG - Intronic
982984174 4:162184051-162184073 TTACATGAAAAGTTTTAGCTTGG + Intergenic
983650836 4:170035111-170035133 CTACATTAACACTTAAATGTAGG - Intergenic
984498419 4:180528611-180528633 CTTCATGAACATATAAAGGTGGG + Intergenic
986462541 5:7987156-7987178 CTCCATGAACACTTAATTCTGGG - Intergenic
987896164 5:23950006-23950028 TTACATAAACAGTTAAATTTTGG - Intergenic
988010706 5:25479115-25479137 CTCCATGAACAGGTGAAGTTGGG + Intergenic
990269458 5:54119859-54119881 CTGCAAGATCAGGTAAAGCTTGG - Intronic
990496635 5:56354388-56354410 TTACATGACAAGTTAAGGCTAGG + Intergenic
995732568 5:115262117-115262139 CTTCATTTACAGTAAAAGCTGGG - Intronic
995889211 5:116931870-116931892 CCACATGAATAAGTAAAGCTAGG + Intergenic
996561889 5:124839136-124839158 AAACATGAAATGTTAAAGCTGGG - Intergenic
996886381 5:128359795-128359817 TTACATGAACAGTTAAGAGTAGG - Intronic
997841602 5:137246056-137246078 CTACTTGAACAGTTAGTGATGGG + Intronic
998840299 5:146246379-146246401 CTATATGAACAATTTAAGATGGG + Intronic
999988571 5:157027948-157027970 CTACATGAACAGTTAAGGCTGGG - Intergenic
1006246675 6:32743158-32743180 CTACATTAAAAGTTAAGGCCGGG - Intronic
1010800066 6:80164936-80164958 CAACATGAACTGTTAAAAATCGG - Intronic
1012145808 6:95680379-95680401 GTACATAAACAGATAAAACTGGG + Intergenic
1013324617 6:109032321-109032343 GTACATGAAAAGGTAAGGCTGGG + Intronic
1016090875 6:139977287-139977309 CTAGATGAACAAATAAAGATAGG - Intergenic
1017383602 6:153857606-153857628 CTACATGACCTGTAAAATCTGGG + Intergenic
1018344818 6:162889363-162889385 CTACCATAACATTTAAAGCTGGG - Intronic
1020369770 7:7419158-7419180 CTGAATGAACAATTAAAACTAGG + Intronic
1022213665 7:28236772-28236794 ATAAATGAACATTTAAAGGTGGG - Intergenic
1022642230 7:32198754-32198776 ATCCAAAAACAGTTAAAGCTAGG - Intronic
1027454801 7:78376102-78376124 CCTCATGTACAGGTAAAGCTGGG + Intronic
1028158536 7:87459833-87459855 ATACATGAACAGATAAAGTTGGG + Intronic
1030232984 7:107227489-107227511 CTAAAGGAACATTTAAAGTTTGG - Intronic
1030908056 7:115211369-115211391 GTACATGAAGAGTTAGAGCAGGG + Intergenic
1032999091 7:137483152-137483174 CTCCATGAATAGTTACAGATAGG + Intronic
1035937385 8:3856675-3856697 CCACATGGCCAGTGAAAGCTGGG + Intronic
1037250120 8:16882428-16882450 CTACATAAACAGTCACATCTGGG - Intergenic
1044937519 8:97307580-97307602 CTTTATGAGCAGTTAGAGCTGGG - Intergenic
1049294997 8:141828110-141828132 CAACGGGAACAATTAAAGCTGGG + Intergenic
1051297221 9:15609407-15609429 CTACATTAAAATTTAAAACTAGG - Intronic
1052628165 9:31003481-31003503 TAACTTGAATAGTTAAAGCTTGG + Intergenic
1055151130 9:73001400-73001422 TTACATGAAAAATTAAAGATGGG - Intronic
1057475654 9:95399030-95399052 CTACATGGACAGTGTAAACTGGG - Intergenic
1058467937 9:105246766-105246788 GTGCATGAACAGTTAAATTTGGG + Intronic
1060138388 9:121180993-121181015 ATACTTGAACAGTTAAGGATGGG + Exonic
1060139702 9:121199871-121199893 CTACATGTAGAGTTAAACCTGGG - Intronic
1060435897 9:123592798-123592820 CTAAATGTACAGTTAAAGCTGGG - Intronic
1188260884 X:28022344-28022366 CTAGATGAACAGTTAAAATATGG - Intergenic
1192275653 X:69628185-69628207 CTACAAGGACAATGAAAGCTTGG + Intronic
1194008490 X:88528958-88528980 CTACCTGAACAACTAAAACTAGG + Intergenic
1199596250 X:149508408-149508430 CTACATTCTCACTTAAAGCTCGG + Intronic