ID: 1099428671

View in Genome Browser
Species Human (GRCh38)
Location 12:82553977-82553999
Sequence TTCACCCTATCCCAAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099428671_1099428672 16 Left 1099428671 12:82553977-82553999 CCTGGGCTTTGGGATAGGGTGAA No data
Right 1099428672 12:82554016-82554038 TGTCCTTCCTACCGTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099428671 Original CRISPR TTCACCCTATCCCAAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr