ID: 1099434078

View in Genome Browser
Species Human (GRCh38)
Location 12:82622829-82622851
Sequence GCCATTATTAATAAAAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099434078_1099434079 17 Left 1099434078 12:82622829-82622851 CCATTACTTTTATTAATAATGGC No data
Right 1099434079 12:82622869-82622891 CTGTGCCAACGTAATGTATTAGG No data
1099434078_1099434081 26 Left 1099434078 12:82622829-82622851 CCATTACTTTTATTAATAATGGC No data
Right 1099434081 12:82622878-82622900 CGTAATGTATTAGGAATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099434078 Original CRISPR GCCATTATTAATAAAAGTAA TGG (reversed) Intergenic
No off target data available for this crispr