ID: 1099434079

View in Genome Browser
Species Human (GRCh38)
Location 12:82622869-82622891
Sequence CTGTGCCAACGTAATGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099434078_1099434079 17 Left 1099434078 12:82622829-82622851 CCATTACTTTTATTAATAATGGC No data
Right 1099434079 12:82622869-82622891 CTGTGCCAACGTAATGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099434079 Original CRISPR CTGTGCCAACGTAATGTATT AGG Intergenic
No off target data available for this crispr