ID: 1099434550

View in Genome Browser
Species Human (GRCh38)
Location 12:82627881-82627903
Sequence GCTGAACAGCCACTCTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099434550_1099434555 18 Left 1099434550 12:82627881-82627903 CCAAATCAGAGTGGCTGTTCAGC No data
Right 1099434555 12:82627922-82627944 GTTTGTTACACTGGTCCCCACGG No data
1099434550_1099434551 -7 Left 1099434550 12:82627881-82627903 CCAAATCAGAGTGGCTGTTCAGC No data
Right 1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG No data
1099434550_1099434552 -4 Left 1099434550 12:82627881-82627903 CCAAATCAGAGTGGCTGTTCAGC No data
Right 1099434552 12:82627900-82627922 CAGCAGCACCGCACTGTAGGTGG No data
1099434550_1099434554 9 Left 1099434550 12:82627881-82627903 CCAAATCAGAGTGGCTGTTCAGC No data
Right 1099434554 12:82627913-82627935 CTGTAGGTGGTTTGTTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099434550 Original CRISPR GCTGAACAGCCACTCTGATT TGG (reversed) Intergenic