ID: 1099434551

View in Genome Browser
Species Human (GRCh38)
Location 12:82627897-82627919
Sequence GTTCAGCAGCACCGCACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099434548_1099434551 5 Left 1099434548 12:82627869-82627891 CCAAAGGAGATGCCAAATCAGAG 0: 25
1: 40
2: 53
3: 80
4: 220
Right 1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG No data
1099434550_1099434551 -7 Left 1099434550 12:82627881-82627903 CCAAATCAGAGTGGCTGTTCAGC 0: 21
1: 71
2: 56
3: 63
4: 141
Right 1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099434551 Original CRISPR GTTCAGCAGCACCGCACTGT AGG Intergenic
No off target data available for this crispr