ID: 1099436978

View in Genome Browser
Species Human (GRCh38)
Location 12:82657290-82657312
Sequence CAGAATAAGGAGGACAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099436978_1099436984 3 Left 1099436978 12:82657290-82657312 CCAGCCCTGTCCTCCTTATTCTG No data
Right 1099436984 12:82657316-82657338 TCAGTTATAAAAGACTGAGGAGG 0: 10
1: 14
2: 16
3: 41
4: 274
1099436978_1099436985 14 Left 1099436978 12:82657290-82657312 CCAGCCCTGTCCTCCTTATTCTG No data
Right 1099436985 12:82657327-82657349 AGACTGAGGAGGTTAATTTGAGG No data
1099436978_1099436986 29 Left 1099436978 12:82657290-82657312 CCAGCCCTGTCCTCCTTATTCTG No data
Right 1099436986 12:82657342-82657364 ATTTGAGGATTTCCTGCATAAGG No data
1099436978_1099436983 0 Left 1099436978 12:82657290-82657312 CCAGCCCTGTCCTCCTTATTCTG No data
Right 1099436983 12:82657313-82657335 CTCTCAGTTATAAAAGACTGAGG No data
1099436978_1099436987 30 Left 1099436978 12:82657290-82657312 CCAGCCCTGTCCTCCTTATTCTG No data
Right 1099436987 12:82657343-82657365 TTTGAGGATTTCCTGCATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099436978 Original CRISPR CAGAATAAGGAGGACAGGGC TGG (reversed) Intergenic
No off target data available for this crispr