ID: 1099437624

View in Genome Browser
Species Human (GRCh38)
Location 12:82662480-82662502
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099437621_1099437624 24 Left 1099437621 12:82662433-82662455 CCAGGACTTTATGAAAAATAGGA No data
Right 1099437624 12:82662480-82662502 TGAGTTCTAAACTTCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099437624 Original CRISPR TGAGTTCTAAACTTCCAGCT TGG Intergenic
No off target data available for this crispr