ID: 1099459871

View in Genome Browser
Species Human (GRCh38)
Location 12:82909316-82909338
Sequence CTGGAGTCCTGCATTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099459869_1099459871 2 Left 1099459869 12:82909291-82909313 CCATCTTCACAGCTAGTTTACTT 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG 0: 1
1: 0
2: 1
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099459871 Original CRISPR CTGGAGTCCTGCATTCATGA AGG Intronic
902353326 1:15876187-15876209 CTGAAGCCCTGCATTTAGGAGGG - Exonic
902778430 1:18689500-18689522 AGGGAGTCCTGCCTTCATCATGG - Intronic
904347135 1:29879925-29879947 CAAGAGTTCTGCCTTCATGAAGG + Intergenic
905261002 1:36719186-36719208 CTGCAATTCTGCCTTCATGATGG - Intergenic
906022828 1:42646238-42646260 CTGGAGTTCTGCATTGTTGCTGG - Exonic
907816620 1:57924383-57924405 CTGGAGTCAGACAGTCATGAAGG + Intronic
908655694 1:66385815-66385837 CTGGAGAGCTGAACTCATGAAGG + Intergenic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
911588937 1:99724146-99724168 ATGGACTTCTGCTTTCATGAAGG - Intronic
911890912 1:103371076-103371098 TTGGAGTCCTGCATTGAGGCAGG - Intergenic
914476237 1:148025143-148025165 CTTGAGTCATGCATCCAGGAAGG - Intergenic
916597444 1:166257942-166257964 CTGGAGTCCTGAAGTCCTCAGGG + Intergenic
916856731 1:168757799-168757821 CTCGGGTCCTGCCTTCAGGATGG + Intergenic
918128760 1:181606804-181606826 ATGCTGTCCTGCATGCATGAGGG + Intronic
918309005 1:183272238-183272260 CTGGATGCCTGCATTGATGCTGG + Intronic
920045011 1:203127483-203127505 CAGGAGTCCTGCATTGAGAAGGG + Exonic
923460197 1:234202994-234203016 ATGGATTCCTTCATTCCTGAAGG + Intronic
924557167 1:245128414-245128436 GTGGAGTCATGCAGTCAGGATGG - Intergenic
924955678 1:248924273-248924295 CTGGAAGCCAGCAGTCATGAAGG - Intergenic
1063639540 10:7816457-7816479 CTGAAGTCCTTCAGTCCTGAGGG - Intergenic
1070336489 10:75459870-75459892 CTGCATTGCTCCATTCATGAAGG + Intronic
1072207457 10:93216813-93216835 TGGGTGTCCTGCATTCATGAAGG - Intergenic
1073536550 10:104281831-104281853 CTGGAGACATGCATACAAGAAGG + Intronic
1074719147 10:116249543-116249565 CAGGAGTCTTTCTTTCATGAAGG - Intronic
1078111115 11:8393423-8393445 CTTGAATCCTGCTGTCATGAGGG + Intronic
1078428636 11:11270573-11270595 CTGCAGCCCTTCATTCCTGAGGG - Intergenic
1078588772 11:12619490-12619512 ATGGAGTCCTGTTTTCAAGAAGG - Intergenic
1080102286 11:28473513-28473535 CTTGGCTCCTGCATTCATGCTGG + Intergenic
1082686957 11:56250681-56250703 CTGTAGTCCCTCATTTATGAGGG + Intergenic
1086198413 11:84170097-84170119 CTGGAGACCTGCTTTGATCAAGG - Intronic
1088780922 11:113133049-113133071 CTGTTGTCCTGCATTGTTGAGGG + Intronic
1091452270 12:580260-580282 CTGGAGTGCTGAATGAATGAAGG + Intronic
1094742238 12:33303190-33303212 TTGGAGTCCTGCATTGAGGCAGG - Intergenic
1098626164 12:72672135-72672157 CTGTAGTCCTGTATAAATGAGGG + Intergenic
1098799331 12:74934229-74934251 CTGGAGTCCTTGATTCTTTAAGG - Intergenic
1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG + Intronic
1100007505 12:89911712-89911734 CTGTATTCATCCATTCATGAGGG + Intergenic
1101534345 12:105603861-105603883 GTGGAGACCTTCATTCCTGAAGG + Intergenic
1102746546 12:115253720-115253742 CTGGAGCTCAGCATTCAGGAAGG + Intergenic
1104024532 12:125016108-125016130 CTGAATGCCTGCATTCATCAGGG + Intronic
1105308435 13:19185453-19185475 CTGGTGTCCTGCATGCAGCAGGG - Intronic
1106086263 13:26544739-26544761 GTGGAGTCCTGCAGTCCTCATGG - Intergenic
1106281430 13:28276377-28276399 CTGAAGTACTCCATTCTTGAAGG + Intronic
1106313649 13:28575477-28575499 CTGGGCTCCTGCAGGCATGAAGG - Intergenic
1107375264 13:39797616-39797638 CTGAGGTCCTGCCTGCATGATGG - Intergenic
1112374940 13:98830436-98830458 CTGGACTCCTGTGTTGATGATGG - Intronic
1112718763 13:102217807-102217829 CTGAAGTGCTGCCTTGATGAGGG + Intronic
1116899607 14:50349391-50349413 CTGGTGGACTGCATCCATGAGGG - Intronic
1119990400 14:79190503-79190525 CTGGAGTGCAGGATTCATTAGGG + Intronic
1120860842 14:89253825-89253847 CTGGAGTCCGGAATCCATCAGGG - Intronic
1122609772 14:102973882-102973904 CTGGCGTCCTGCATGCAGCAGGG + Intronic
1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG + Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1129877275 15:78983930-78983952 CTGTAGTCCTGCTGTCATCAGGG + Intronic
1134275761 16:12774720-12774742 ATGGACTCATCCATTCATGAGGG - Intronic
1134789303 16:16974312-16974334 CTGAAGTGCTGAATTCATCAAGG - Intergenic
1134912338 16:18038989-18039011 CTGGAGTCTGGGGTTCATGAGGG - Intergenic
1138096394 16:54215220-54215242 CTGGGGTCCTGCTTCCCTGAAGG - Intergenic
1140864437 16:79047830-79047852 TTGTAGTCCTGCATGAATGAAGG + Intronic
1141985468 16:87576967-87576989 ATGGGGTCCTGCGGTCATGAGGG - Intergenic
1144036672 17:11372162-11372184 CTGGAATCCAACATCCATGATGG - Intronic
1144377602 17:14661011-14661033 CCTGAATCCTGCATTCATCATGG - Intergenic
1149811399 17:59676976-59676998 CTAGAGGCCAGAATTCATGAGGG + Exonic
1152397348 17:80041830-80041852 CTGGAATCCTGCATCCCTGGTGG - Intronic
1153858523 18:9174486-9174508 CTGGTGGCCTGGGTTCATGAGGG + Intronic
1156377835 18:36530821-36530843 CAGGAGTCTTGCATTCATCCTGG + Intronic
1158536263 18:58310751-58310773 CTGGCGTCATGCATTACTGAGGG + Intronic
1160142727 18:76339750-76339772 TTGGAGTCATCCATTCATGTGGG + Intergenic
1160774050 19:846657-846679 CTGGAGTCCTGGATTCTGGAAGG - Intronic
1164804491 19:31105968-31105990 CTGGAATGCTGAATTCAGGAGGG + Intergenic
1165984700 19:39757860-39757882 CTGCAGTCCTTCATCCCTGAGGG + Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167249570 19:48392936-48392958 CTGGACTCCTGCATCTATGAGGG + Intergenic
1168092554 19:54095568-54095590 CTGGAGTCCTGGGTCCAGGAAGG + Exonic
925121210 2:1419809-1419831 CTGGACTCCTGCTTCCACGAGGG - Intronic
925661543 2:6208494-6208516 CAGGAAACCTGCAATCATGATGG - Intergenic
926010787 2:9405911-9405933 CTGGAGACCAGGATTCATGCTGG - Exonic
927937180 2:27082618-27082640 CTGGAGAGCAGCATTCCTGAGGG - Exonic
928867263 2:35931861-35931883 ATGGAGTTCTGCCTTCCTGACGG - Intergenic
929280519 2:40072860-40072882 CTGGTGTAGTGTATTCATGAGGG + Intergenic
929454980 2:42059120-42059142 CAGAAGCCCTGCATTCATGGCGG - Intergenic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
931785421 2:65613694-65613716 CTGGTGTCCTGCATTTTTCAGGG + Intergenic
933823599 2:86138399-86138421 CAGCATTCCTGCCTTCATGAGGG + Exonic
934679322 2:96271286-96271308 CTGGCCTCCTGCAGTGATGATGG + Exonic
935135020 2:100292333-100292355 CTGGAGAGCTGCACTCACGAAGG - Intronic
936595094 2:113840114-113840136 CTAGAGTCCTGCCTTCCAGAAGG - Intergenic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
939776515 2:146393867-146393889 CTAGAGTGGTGCATTCATCATGG - Intergenic
941360356 2:164543413-164543435 AGGGAGTCCAGCATCCATGATGG - Intronic
945987297 2:216365262-216365284 CTGGAGTTCTGCATTCAGAAGGG - Intronic
946195324 2:218029165-218029187 CTGGAGTCCTGCATTGGAGTGGG - Intergenic
947329200 2:229010988-229011010 CTGGAGTTATTGATTCATGATGG + Intronic
947853330 2:233306232-233306254 CTGGAGTCCAGGCTCCATGAGGG - Intergenic
948263008 2:236618086-236618108 CTGGACTCCTGCAGTCCTCAAGG + Intergenic
948652749 2:239458745-239458767 ATGGATTAATGCATTCATGAGGG + Intergenic
1172231577 20:33340238-33340260 CTGGGGTCCTGCCTTCAAGCAGG - Intergenic
1177641992 21:23855452-23855474 CTGGAGACCTAGCTTCATGAAGG - Intergenic
1179620560 21:42613049-42613071 CTGGGGTCCTTCATGCGTGAGGG - Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
949905088 3:8852480-8852502 CTGGAGCCCTGGATTCTGGAGGG + Intronic
951086080 3:18514635-18514657 CTGGATTAATCCATTCATGAGGG - Intergenic
951777316 3:26324273-26324295 CTGGAGTGCTCCGTTCATCACGG + Intergenic
952978331 3:38715096-38715118 CTGGAGCCTTGCATGAATGAAGG - Intronic
954454080 3:50587646-50587668 CTGGAGTTCTGCAGACATGCGGG + Intergenic
955095297 3:55790939-55790961 GTGGAATCCTCCATTCCTGATGG + Intronic
957774598 3:84740155-84740177 CTTGAATGCTTCATTCATGATGG - Intergenic
958516339 3:95121068-95121090 CTGGAGCCCTGGAGGCATGAGGG + Intergenic
960130651 3:114052468-114052490 CTAGAGACTAGCATTCATGATGG + Intronic
964034198 3:152176237-152176259 CTGGAGTTCTGTTTTCATAATGG + Intergenic
965924071 3:173956559-173956581 GTGAAGTCCTGCCTACATGATGG - Intronic
968694878 4:2019312-2019334 CTGGGGTCCTGCCCTCAGGAGGG + Intronic
970381233 4:15509934-15509956 CTGTAGAACTGCATGCATGACGG - Intronic
977249846 4:94677437-94677459 GTGGAGTACAGCATTCATGTTGG - Intergenic
977463343 4:97354091-97354113 CTGGAGTAATTCATTCATGAGGG + Intronic
978191705 4:105921469-105921491 TTTGAGTTCTGTATTCATGAGGG + Intronic
979390324 4:120119708-120119730 CTGGAATCATGCATGCAGGAAGG + Intergenic
983390930 4:167128868-167128890 CTGGAATCCTCCATTCAGGGTGG - Intronic
984899175 4:184569615-184569637 CTGGAGTCCTTCATCAACGAAGG + Intergenic
985020728 4:185686827-185686849 CTGCACTGGTGCATTCATGAGGG + Intronic
987501052 5:18709728-18709750 CTGGAAGCTTACATTCATGATGG + Intergenic
988913634 5:35870739-35870761 TTGGAGTCCTGCATTACAGACGG - Intronic
989990511 5:50758800-50758822 TTGGAGACCTGTATTCATTAGGG + Intronic
990619369 5:57543255-57543277 CTGGAGTATAGGATTCATGAAGG - Intergenic
991977594 5:72198426-72198448 CTGGAGTCCTGCATGTCAGAAGG - Exonic
993984121 5:94576374-94576396 ATGGATTACTCCATTCATGAGGG - Intronic
1001676644 5:173523565-173523587 CTGGAGGTCTTCATTCATCAAGG + Intergenic
1002140510 5:177134509-177134531 CAGCAGGCCTGCATTCAGGAAGG + Intronic
1010956033 6:82091835-82091857 CTGTAGCACTGCATTCATGTTGG - Intergenic
1012394266 6:98777991-98778013 CTGGAGTCCTTTATTCATTGTGG - Intergenic
1013066756 6:106691382-106691404 ATGTAAGCCTGCATTCATGATGG + Intergenic
1013620480 6:111883448-111883470 CTGAAGTGCTGTATACATGAGGG + Intergenic
1015024801 6:128520204-128520226 CTGGAGTCCTGGGCTCACGAGGG - Intronic
1016812766 6:148277153-148277175 CTGGAGTCTTGCACTCTTAATGG + Intronic
1019452628 7:1107783-1107805 CTGGAGTCCTGCACCCCTGGAGG + Intronic
1020048972 7:5068891-5068913 CTGGAGTCTTTCATTCAGCAAGG - Exonic
1021859378 7:24891145-24891167 CTGCAGTTCTGTTTTCATGAGGG - Intronic
1022839669 7:34151094-34151116 CTGGAGTCCACCATGCATGAGGG + Intronic
1023848497 7:44137649-44137671 CTGGTGGCCTGCTTTCAGGATGG + Intergenic
1024530221 7:50385154-50385176 CAGCAGCCCTGCATCCATGATGG - Intronic
1031331193 7:120466809-120466831 CAGGAGTCCTGCATTCCTTCTGG + Intronic
1035812857 8:2506895-2506917 CTGGTGTCCAGCTTTCCTGAAGG + Intergenic
1037721819 8:21450752-21450774 CTGGCTTCCTCCCTTCATGATGG + Intergenic
1039390965 8:37180485-37180507 TTTTAGTCCTGGATTCATGAGGG + Intergenic
1039449816 8:37663427-37663449 ATGGACTCCTCCACTCATGAAGG + Intergenic
1039504938 8:38044969-38044991 TTGGAGTGCTGCATGAATGAAGG - Intronic
1041133121 8:54723978-54724000 CTTCAGTCCTGCATTTTTGAGGG - Intergenic
1041615214 8:59898983-59899005 CTGGAGAAATGCATTCATGAGGG - Intergenic
1041992117 8:64005917-64005939 CTGGGGTCCAGCATGAATGAGGG - Intergenic
1046023819 8:108698662-108698684 CTGAACTCCTACAGTCATGAAGG - Intronic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1049605548 8:143527633-143527655 CTGGAGTCCTGCTTTCATAAGGG - Intronic
1050503518 9:6323493-6323515 CTGCATTCATTCATTCATGAGGG + Intergenic
1055607866 9:77989700-77989722 CTGGACTGCTCCATACATGAAGG + Intronic
1059149593 9:111937497-111937519 CTGGTGTCCGTCAGTCATGAGGG - Intergenic
1061324079 9:129852210-129852232 TGGGAGTCCTGCATGCATGCAGG - Intronic
1061677412 9:132226089-132226111 CTGGAGCTATGCATTCATCAGGG + Intronic
1062424367 9:136499210-136499232 CTGGATGCCCGCATGCATGATGG - Exonic
1185672117 X:1821186-1821208 GTGGAGTAATCCATTCATGAGGG - Intergenic
1188066351 X:25665124-25665146 CTGGAGTCCAGAATGAATGAAGG + Intergenic
1195985514 X:110626254-110626276 CTGGAGTGCAGCATTCCTCATGG - Intergenic
1198594488 X:138221707-138221729 CTGGACTGTTGCCTTCATGAAGG - Intergenic
1199938874 X:152604647-152604669 CTGCAGTCATCCATTCATGAGGG + Intergenic
1200512753 Y:4100051-4100073 CTGGAGTTGTTCATTCCTGACGG - Intergenic