ID: 1099470481

View in Genome Browser
Species Human (GRCh38)
Location 12:83042005-83042027
Sequence TGCAAACAAGAACCTCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099470481 Original CRISPR TGCAAACAAGAACCTCAAAG TGG (reversed) Intronic
900568251 1:3345924-3345946 AGCCAACAAGAGCCCCAAAGAGG + Intronic
901856665 1:12048810-12048832 TGAAAACAAAAACCAAAAAGAGG - Intergenic
901862423 1:12083086-12083108 TGCAAATAAAAACCACAATGAGG + Intronic
905406667 1:37737595-37737617 TGCAAAAAATGAACTCAAAGTGG + Intronic
905608669 1:39328567-39328589 TGCAAAAAAGAACCCCAAACAGG - Intronic
908594842 1:65676476-65676498 TCCAAACATTAACCTAAAAGTGG + Intergenic
909667205 1:78148269-78148291 AGCAAACAAAAACATAAAAGTGG + Intergenic
913528690 1:119717011-119717033 TGCACAGAAGAACTACAAAGTGG - Intronic
913793777 1:122576476-122576498 TCCAACGAAGGACCTCAAAGGGG - Intergenic
913822849 1:123097618-123097640 TCCAACGAAGAGCCTCAAAGAGG - Intergenic
913823465 1:123108835-123108857 TTCTACCAAGGACCTCAAAGCGG - Intergenic
913834399 1:123304931-123304953 TTCTAACATGGACCTCAAAGCGG - Intergenic
913846577 1:123523294-123523316 TTCTAACATGGACCTCAAAGCGG - Intergenic
913879438 1:124112267-124112289 TTCTAACATGGACCTCAAAGCGG - Intergenic
913907140 1:124609143-124609165 TTCTACCAAGGACCTCAAAGCGG - Intergenic
913913716 1:124727099-124727121 TTCTAACACGGACCTCAAAGCGG - Intergenic
913935038 1:125031384-125031406 TTCAAACGAAAGCCTCAAAGTGG - Intergenic
915501296 1:156320054-156320076 TGGAAACAAAAACCTATAAGAGG - Intronic
915790756 1:158668165-158668187 TGCTAACAAGAAGATAAAAGGGG + Intronic
918018568 1:180662768-180662790 TCTAGACAAGAACCTCAAAAGGG - Intronic
918235969 1:182581110-182581132 GGCAAACCAGAGGCTCAAAGAGG - Intronic
918259471 1:182782516-182782538 GGTCAACAAGAAGCTCAAAGTGG + Intergenic
918670766 1:187212585-187212607 TGAAAACATGAAACTGAAAGAGG + Intergenic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
919172987 1:193979790-193979812 TGCAAAAAACAATCCCAAAGAGG - Intergenic
919592930 1:199527060-199527082 TGTAAAAAATTACCTCAAAGTGG - Intergenic
919638801 1:200029739-200029761 TGCGAACAAGATCCTGAAAGAGG - Intronic
921461793 1:215435984-215436006 TGCAAACCAAAACCACAATGAGG - Intergenic
922162146 1:223085965-223085987 TGCAAAGAAGAACCTGAAACTGG + Intergenic
923079139 1:230637192-230637214 TGGAAACCAGACCCCCAAAGAGG + Intergenic
924039871 1:239973956-239973978 TGAAAACATGAAGCTCAGAGAGG + Intergenic
924786595 1:247205311-247205333 TGTAAACAAGAACCTCAGCAGGG - Intergenic
924906835 1:248463695-248463717 AGCAAACAAAAACATAAAAGTGG + Intergenic
924917284 1:248584432-248584454 AGCAAACAAAAACATAAAAGTGG - Intergenic
924917581 1:248589336-248589358 TGCAAACTAAAACCACAACGAGG + Intergenic
1062891997 10:1069530-1069552 TGGAAAAAAGAATCTCAAAAAGG + Intronic
1063776518 10:9271791-9271813 TGCAAACCAAAACCACAATGAGG - Intergenic
1064513715 10:16123525-16123547 TGCTGACATGAAGCTCAAAGGGG + Intergenic
1064933443 10:20652987-20653009 TGCAAACCAAAACCCCAATGAGG - Intergenic
1066511149 10:36098141-36098163 TGCAAACAAGACCTACAAATAGG - Intergenic
1066620988 10:37349544-37349566 TGCAAAAAATAAATTCAAAGAGG + Intronic
1066927102 10:41711127-41711149 TTCAAACAAAGGCCTCAAAGAGG - Intergenic
1068590268 10:58846010-58846032 TGGAAACAAGAAGCAGAAAGAGG + Intergenic
1068815519 10:61306057-61306079 TGCAAACAAGCACCCAAATGAGG + Intergenic
1069221973 10:65895014-65895036 TCCAAGCAAGAATTTCAAAGTGG + Intergenic
1069376641 10:67799928-67799950 TGCAGACAAGAACTTGAAACAGG + Intronic
1069863535 10:71486189-71486211 TGGAAATAAGGACCCCAAAGAGG - Intronic
1070609640 10:77924765-77924787 TGCAAGTCAGAAGCTCAAAGTGG + Intronic
1070755639 10:78991376-78991398 TGCAAATAAAAACCACAATGAGG + Intergenic
1071011477 10:80945178-80945200 TTAAAACAATAACCTAAAAGAGG + Intergenic
1073078794 10:100843309-100843331 TGCAATTAATAACCTCAGAGAGG + Intergenic
1073283609 10:102373285-102373307 TGCAAACTAAAACCACAATGAGG + Intronic
1074653744 10:115558350-115558372 AGCCAATAAGAACCTCAAATTGG - Intronic
1075366425 10:121894416-121894438 TGCAAACAAGAATCACAACATGG + Intronic
1076074806 10:127524734-127524756 TGCAAAAAAGAAAACCAAAGTGG - Intergenic
1077959859 11:7063999-7064021 TGCAAACATGTAACTGAAAGGGG + Intronic
1078109287 11:8379570-8379592 TGCAAATTAGAACCACAATGAGG + Intergenic
1078556588 11:12332016-12332038 TCCAAACAAGGATCTCAATGAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080240510 11:30122031-30122053 TGCCAAGAAGATCCTAAAAGGGG - Intergenic
1080720155 11:34840773-34840795 TGGTAAAAAGAACATCAAAGTGG - Intergenic
1081153080 11:39656227-39656249 TGAAAGACAGAACCTCAAAGGGG + Intergenic
1082529141 11:54085735-54085757 TTCCAACAAAATCCTCAAAGAGG - Intergenic
1082534118 11:54158013-54158035 TTCCAACAAAATCCTCAAAGAGG - Intergenic
1083080940 11:60092744-60092766 TGAAAACAAGAAACTCATTGTGG + Intronic
1083563429 11:63692805-63692827 TGCAAAAAAGAAAACCAAAGTGG - Intronic
1086344193 11:85879526-85879548 TGCAAATAAAAACCACAATGAGG + Intronic
1087185233 11:95184407-95184429 TGCAAAAAAGCACCTGAATGAGG + Exonic
1088215947 11:107509652-107509674 TGCAAAGAAAAACCTCAAAATGG - Intronic
1089021342 11:115218421-115218443 TGAAAACAAGAACATAGAAGAGG - Intronic
1090641195 11:128730258-128730280 TGAAAACTGGAATCTCAAAGAGG + Intronic
1090877104 11:130800327-130800349 TGCAAACCAAAACCACAATGAGG - Intergenic
1092149673 12:6238989-6239011 TTCAAACAAGTACCTCTTAGTGG - Intergenic
1093592669 12:20923013-20923035 TGCAAATAAAAACCACAATGAGG - Intergenic
1093906617 12:24700988-24701010 TGCAAATGAAAACCTCAATGAGG + Intergenic
1094110932 12:26861970-26861992 TGCAAATTAGAACCACAATGAGG - Intergenic
1094436172 12:30423167-30423189 GGCAAACAAGAACATAAAATTGG + Intergenic
1094953564 12:35968046-35968068 TCCAACGAAGAGCCTCAAAGAGG - Intergenic
1095016579 12:36986999-36987021 TTCCAACAAAGACCTCAAAGAGG - Intergenic
1095025380 12:37129312-37129334 TTCCAACAAAGACCTCAAAGAGG - Intergenic
1095721981 12:45410728-45410750 TGTAAACAGGAACCACAAAGGGG - Intronic
1096190974 12:49618961-49618983 TGGAAACAAGAAGTTCAGAGAGG + Intronic
1097486564 12:60210807-60210829 TAGAAACTAGAACCTCAGAGAGG - Intergenic
1099066939 12:77992753-77992775 TGGAAACAAGCACCCCAAAAAGG + Intronic
1099470481 12:83042005-83042027 TGCAAACAAGAACCTCAAAGTGG - Intronic
1099725609 12:86423898-86423920 TTCAAAAAGGAGCCTCAAAGGGG + Intronic
1100113410 12:91272790-91272812 TGACAACAAGAAATTCAAAGGGG + Intergenic
1100188396 12:92162676-92162698 TGCAAATTAAAACCTCAATGAGG - Intergenic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1103833855 12:123803217-123803239 TGAAAATAAAAACCCCAAAGTGG - Intronic
1108128583 13:47272067-47272089 TGCAAATTAAAACCTCAATGAGG - Intergenic
1108836779 13:54560186-54560208 TGCACACCATAACCTCAAGGAGG + Intergenic
1109432499 13:62253486-62253508 TGCAAATCAGAACCACAATGAGG - Intergenic
1109703238 13:66054878-66054900 TGCAAACCAAAACCACAATGAGG + Intergenic
1110418491 13:75278422-75278444 TGCATACAAAAACCTTGAAGAGG - Intergenic
1112424934 13:99289716-99289738 TGCAAACAAGAAACACACTGTGG - Intronic
1113042665 13:106121436-106121458 TGAAAACATAAATCTCAAAGTGG + Intergenic
1113259563 13:108546726-108546748 TGCAACACAGAACCCCAAAGTGG + Intergenic
1115003369 14:28449218-28449240 TGAAAACAATAACCTCCAAATGG + Intergenic
1116658918 14:47682753-47682775 TGTTAACAAGCACCTCAAACTGG - Intergenic
1117931356 14:60843976-60843998 TGCAAAAAAGAAACCCAAACAGG - Intronic
1118560954 14:67081864-67081886 AGCAAACAAAAACATAAAAGTGG - Intronic
1118705644 14:68477956-68477978 TTCAACCAGGCACCTCAAAGCGG + Intronic
1119098867 14:71860828-71860850 AGCAAACAAAAACATAAAAGTGG + Intergenic
1119791118 14:77350980-77351002 TACAAACCAGAAGCTTAAAGCGG - Intronic
1119821775 14:77622541-77622563 TGCAAACATGAAGCTTTAAGAGG + Intergenic
1120546008 14:85812333-85812355 AGCAAAGACGAACCTCAAACTGG - Intergenic
1121650965 14:95558059-95558081 TGCAAACCAAAACCACAATGAGG + Intergenic
1122705439 14:103618005-103618027 TGCAAATTAAAACCACAAAGAGG + Intronic
1122881992 14:104694339-104694361 GGCAAACAAGATCCTCAGCGTGG - Intronic
1125072285 15:35569533-35569555 TGCAAATCAGAACCTCAATAAGG - Intergenic
1125140123 15:36396179-36396201 TGCAAACAAAAACCAGAAGGTGG - Intergenic
1125593843 15:40872305-40872327 TGCAAATTAGAACCTGAAGGAGG - Exonic
1125686006 15:41563774-41563796 TGCAAATAACAACCCCAAGGGGG + Intronic
1126535806 15:49762660-49762682 TGCAAATAAAAACCACAATGAGG - Intergenic
1126963248 15:54022472-54022494 TGCAAATTAAAACCACAAAGAGG - Intronic
1127050551 15:55079119-55079141 AGCAAACAAAAACATCAAATGGG + Intergenic
1128473551 15:67976877-67976899 TGCAAATAAAAACCACAATGAGG - Intergenic
1129555971 15:76509950-76509972 AGCAAACAAAAAACTTAAAGTGG + Intronic
1131245323 15:90786912-90786934 TGCAAATCAAAACCACAAAGAGG - Intronic
1131304695 15:91231637-91231659 TGCAAATAAGCACCTCAACCTGG + Intronic
1131782849 15:95878361-95878383 TCAAAACCAGAACCTCAAAATGG - Intergenic
1132116599 15:99141018-99141040 TACAAACTAAAACCTCAATGAGG + Intronic
1136715196 16:32274810-32274832 TGCAAATCAGAACCACAATGAGG + Intergenic
1136752719 16:32654918-32654940 TGCAAATCAGAACCACAATGAGG - Intergenic
1136821872 16:33325524-33325546 TGCAAATCAGAACCACAATGAGG + Intergenic
1136828435 16:33382063-33382085 TGCAAATCAGAACCACAATGAGG + Intergenic
1136833501 16:33480836-33480858 TGCAAATCAGAACCACAATGAGG + Intergenic
1139049572 16:63107308-63107330 TGCAACCATGAAGGTCAAAGAGG - Intergenic
1139266009 16:65639101-65639123 TGGAAACCAGACCCTCAAAGAGG + Intergenic
1140239068 16:73184641-73184663 TGCAAGCAAGAACCCCACACTGG - Intergenic
1141064267 16:80901269-80901291 GGCAGACAAGAATCTCACAGGGG - Intergenic
1142149884 16:88507940-88507962 TGTAAACAGGAACCTAAAAAGGG + Intronic
1202993973 16_KI270728v1_random:38419-38441 TGCAAATCAGAACCACAATGAGG + Intergenic
1203011415 16_KI270728v1_random:243686-243708 TGCAAATCAGAACCACAATGAGG - Intergenic
1203054856 16_KI270728v1_random:914959-914981 TGCAAATCAGAACCACAATGAGG - Intergenic
1142958709 17:3538297-3538319 TATAAACAAGCACCTCACAGAGG + Intronic
1143361293 17:6373774-6373796 TGCAAATTAAAACCACAAAGAGG + Intergenic
1143871851 17:9962641-9962663 TGCAAACCCCAGCCTCAAAGGGG + Intronic
1143933514 17:10457173-10457195 AGAAAACAAGAATCTCAGAGAGG - Intronic
1144290776 17:13824191-13824213 TGCAACAAAGAACCACAAACTGG + Intergenic
1144812979 17:18013079-18013101 TGCAAATAAGAACCAGAATGAGG + Intronic
1149803559 17:59593361-59593383 TGCAAATTAAAACCACAAAGAGG - Intronic
1149842932 17:59982126-59982148 TGCAAATTAAAACCACAAAGAGG + Intergenic
1152076129 17:78161073-78161095 TGGAACCAAGAACATCAAGGTGG + Exonic
1152116158 17:78388693-78388715 TTCAAACAAGGAACTCAGAGGGG - Intronic
1153534447 18:6085823-6085845 TGCATACATGAACATCAAAAAGG + Intronic
1154071413 18:11155544-11155566 AGCACACAAAAACCCCAAAGTGG - Intergenic
1155371772 18:25109663-25109685 TGCAAACTAAAACCACAATGAGG - Intronic
1155379089 18:25198290-25198312 TGAAAACAAGAATGTCAAAAAGG - Intronic
1156022181 18:32612333-32612355 TGCAAACCAAAACCACAATGAGG - Intergenic
1156738269 18:40291010-40291032 TGCAAACCAAAACCACAAACAGG + Intergenic
1159214815 18:65377767-65377789 TGCAAATCAAAACCTCAATGAGG - Intergenic
1161776966 19:6268948-6268970 TGAAATCAACAGCCTCAAAGTGG + Intronic
1162370879 19:10278509-10278531 TGCAGAAAAGACCTTCAAAGAGG - Intronic
1162941468 19:14012262-14012284 AGCAAACAAAAACATAAAAGGGG + Intergenic
1164101698 19:22060364-22060386 TGCAAACAAAAACCACAATGAGG - Intronic
1167054650 19:47102048-47102070 AGAAAACAAGAACTTCCAAGTGG + Intronic
926875553 2:17473351-17473373 AGCAAGCAAGAAGCTCAATGGGG + Intergenic
927306106 2:21575110-21575132 TGTAAACAAAAAGCTCAAAGTGG - Intergenic
927468560 2:23355118-23355140 TGCAATGAGGAACCTCAAAGTGG + Intergenic
927574771 2:24191925-24191947 AGCAGATAAGAACCTCAAACAGG - Intronic
928442839 2:31306815-31306837 AGCAAACAAAAAACTTAAAGTGG - Intergenic
929219808 2:39451593-39451615 TGAAAAAAAAAACATCAAAGAGG - Intergenic
929497027 2:42454057-42454079 TGCAAATCAGAACCACAATGAGG + Intronic
929839141 2:45438446-45438468 AGCAGACAAGAACTTTAAAGTGG + Intronic
929965497 2:46531741-46531763 TGTAAATAAAAACCTCAATGAGG - Intronic
930097353 2:47575463-47575485 TGAGAACAAGAAGATCAAAGAGG - Intergenic
930461599 2:51685869-51685891 TTTAAACATGTACCTCAAAGTGG + Intergenic
930487764 2:52028853-52028875 TGCAAATTACAACCACAAAGAGG - Intergenic
931208996 2:60174815-60174837 TGAAAACAGGATCTTCAAAGAGG - Intergenic
931946964 2:67320037-67320059 TGCAAACAAAACACTAAAAGAGG - Intergenic
934472202 2:94558539-94558561 TTCCAACGAAAACCTCAAAGCGG + Intergenic
934863524 2:97785450-97785472 TGCAAATAAAAACCACAAAGAGG + Intronic
935864481 2:107370822-107370844 TGCAAATCAAAACCTCAATGAGG - Intergenic
936115396 2:109698571-109698593 AGCATACAAGAACCTTAAAATGG - Intergenic
937167913 2:119837743-119837765 GGAACACAAGAACCCCAAAGAGG - Intronic
937177899 2:119960129-119960151 TGCAAACTAGAAGCTGAAATGGG + Intronic
938090275 2:128426681-128426703 TGACAAGAAGAACCTCACAGCGG + Intergenic
938533429 2:132217229-132217251 TTCCAACAAAAGCCTCAAAGTGG - Intronic
938583139 2:132666059-132666081 AGGAAACAAGATCCTGAAAGAGG + Intronic
938733627 2:134165945-134165967 TGAAAAATAGTACCTCAAAGAGG + Intronic
938866141 2:135422880-135422902 TGTAAAAAAGTACCACAAAGTGG + Intronic
938960706 2:136338351-136338373 AGCAAACAAAAACTTAAAAGTGG - Intergenic
939434288 2:142153838-142153860 TGCAAACCAAAACCACAATGTGG - Intergenic
941622865 2:167798004-167798026 TGCAAACCAAAACCACAATGAGG - Intergenic
942203653 2:173597229-173597251 TGCAAAGAAGAAACTCAAAATGG - Intergenic
942483695 2:176417277-176417299 TGCAAACAAGTACATGAATGTGG - Intergenic
943548658 2:189311883-189311905 TATAAAGAAGAACCACAAAGAGG - Intergenic
943858103 2:192824916-192824938 TGCAAACGAAAACCACAATGAGG + Intergenic
944928571 2:204491957-204491979 TGCCTAGAAGACCCTCAAAGAGG + Intergenic
945004879 2:205394246-205394268 GGTAGACAAGAACCTCAGAGAGG - Intronic
946645574 2:221829933-221829955 TTCAAACAAGAACCAGAAATGGG - Intergenic
1170050289 20:12135554-12135576 AGCAAACAAAAACATAAAAGTGG - Intergenic
1172469813 20:35184279-35184301 AGCAAACAAAAACATAAAAGTGG + Intergenic
1174031046 20:47626880-47626902 TGGAAACAAGACCTTCAAGGAGG - Intronic
1174379394 20:50146926-50146948 TACAAACAAGAATCAGAAAGGGG - Intronic
1174442259 20:50565588-50565610 TGGAAACAAAATCCTGAAAGTGG + Intronic
1174695744 20:52555657-52555679 TGCAAACGAAAACCACAATGAGG - Intergenic
1174838839 20:53882726-53882748 TGCACATCAGAACATCAAAGAGG - Intergenic
1175675335 20:60941907-60941929 TGCATACAACAACCTGATAGAGG - Intergenic
1175693802 20:61086027-61086049 TACAAACATGAACCACAAGGTGG + Intergenic
1178811431 21:35886050-35886072 TGAAAACGAGAATCTCATAGAGG + Intronic
1180507800 22:16033684-16033706 TTCCAACGAAAACCTCAAAGCGG + Intergenic
1180629722 22:17220061-17220083 TGGAAACAAGCACCGCAAAGAGG + Intronic
1180636051 22:17263911-17263933 TCCAATCAAGAACCTGAAGGTGG - Intergenic
1183047958 22:35236016-35236038 AGCAAACAAGAACCTAAAGTTGG - Intergenic
1183907768 22:41055179-41055201 TGTAATTAAGAATCTCAAAGTGG - Intergenic
1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG + Intronic
1184756845 22:46521200-46521222 TGAAAACAAGATCTTTAAAGAGG - Intronic
1184825872 22:46950465-46950487 TGGACACAAGGACCTCAAAACGG - Intronic
1185034461 22:48464564-48464586 TGCAAACAATAGGCTCAAAAAGG - Intergenic
949346431 3:3081089-3081111 TGGAAAACAGACCCTCAAAGTGG + Intronic
949434369 3:4012636-4012658 TGCAAACCGAAACCACAAAGAGG + Intronic
951094520 3:18612922-18612944 AGCAAACAAAAACATAAAAGTGG + Intergenic
952097024 3:29965993-29966015 AGCAAACAAAAACATAAAAGTGG - Intronic
953052675 3:39360083-39360105 TGCAAAAAAGAAAACCAAAGTGG - Intergenic
953297266 3:41732391-41732413 TGCAAACTAAAACCACAATGAGG + Intronic
955045493 3:55355656-55355678 AACAAACAAAAACCTGAAAGTGG - Intergenic
955264148 3:57425072-57425094 TGCAAAGTAGCACTTCAAAGAGG + Intronic
957861345 3:85955470-85955492 AGGAAGCAAGAACCTAAAAGAGG + Intronic
958129964 3:89405785-89405807 TGCAAATAAGAGCATAAAAGAGG + Intronic
958219359 3:90644008-90644030 TTCAAACAAAGACCACAAAGAGG + Intergenic
958279066 3:91632461-91632483 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958285157 3:91732328-91732350 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958309427 3:92129797-92129819 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958317576 3:92262679-92262701 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958333992 3:92532184-92532206 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958345746 3:92724969-92724991 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958351297 3:92815633-92815655 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
958404457 3:93735740-93735762 TACCAACAAAGACCTCAAAGCGG + Intergenic
958484909 3:94692966-94692988 TTCAAAAAAGAACCACAGAGTGG - Intergenic
958514414 3:95094314-95094336 TGAAAACAAGAAACTCAGATGGG + Intergenic
958831091 3:99090382-99090404 TGCAAATAAAATCCTCAATGAGG + Intergenic
959865112 3:111258235-111258257 TGCAAATTAAAACCTCAATGAGG - Intronic
961700018 3:128736458-128736480 AGTAACCAATAACCTCAAAGTGG + Intronic
962194770 3:133352088-133352110 TGTAAATAAGATGCTCAAAGTGG - Intronic
962613514 3:137101891-137101913 TGAAGACAAGAACTTTAAAGAGG + Intergenic
964270665 3:154952536-154952558 TGCAAATCAAAACCTCAATGAGG + Intergenic
964305452 3:155334647-155334669 TTAAAACAAGAAACTCAAAAAGG + Intergenic
964501063 3:157348465-157348487 TGCAAACCAAAACCACAATGAGG - Intronic
964501248 3:157350799-157350821 TGCAAACCAAAACCACAATGAGG + Intronic
965183232 3:165431509-165431531 AGCAAACAAAAACATAAAAGTGG - Intergenic
965901881 3:173651673-173651695 TGCAAACTAAAACCACAATGAGG - Intronic
966229505 3:177636133-177636155 AGCAAACAAAAACATAAAAGTGG - Intergenic
966467161 3:180242890-180242912 AGCAAACAAAAACATAAAAGTGG - Intergenic
969138502 4:5050293-5050315 TGCAGATAAGAACTCCAAAGTGG + Intergenic
970304165 4:14714234-14714256 TGCAAACTAAAACCACAAGGGGG + Intergenic
971611870 4:28736180-28736202 AGGAAACCAGAACCTCCAAGTGG - Intergenic
974640565 4:64624696-64624718 TACAAAGAAGAACCTAAAAAGGG - Intergenic
974715940 4:65669380-65669402 TGCAACCAAAAACCGCAGAGGGG + Intronic
974753580 4:66173476-66173498 TGCAAATCAAAACCTCAAAATGG - Intergenic
975075835 4:70207926-70207948 TGCAAATCAAAACCTCAATGCGG - Intergenic
975298542 4:72763093-72763115 TACAACCAAACACCTCAAAGAGG - Intergenic
975944652 4:79690948-79690970 AGCAAACAAAAACCTAAAGGTGG - Intergenic
977011754 4:91644027-91644049 AGCAAACAAAAACATCAAACTGG - Intergenic
977083015 4:92557109-92557131 TGCAAACAAAAACCAAGAAGGGG - Intronic
980288676 4:130815089-130815111 TGCAAATAAAAACCACAATGAGG - Intergenic
980459492 4:133088998-133089020 TGCAAACAAAAACCTGAAAAGGG + Intergenic
982271253 4:153591469-153591491 TTATAACAAGAAGCTCAAAGGGG + Intronic
982547146 4:156748190-156748212 TGTGAACAACAACCTCAAGGAGG - Intergenic
983233887 4:165157134-165157156 GGCAAACAAAAACATAAAAGTGG + Intronic
983942001 4:173543915-173543937 TGCAAAAAATAACCTAAAAAGGG + Intergenic
984290227 4:177785373-177785395 AGCAAACAAAAACCTAAAGGGGG + Intronic
987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG + Intronic
987085437 5:14463312-14463334 TGCATGCAAAAACCTCACAGAGG - Intronic
987107192 5:14651754-14651776 TGCAAAAAAGAAAACCAAAGTGG + Intergenic
987684191 5:21175555-21175577 TAAAAACAAGTACCTGAAAGTGG + Intergenic
989611135 5:43292863-43292885 TGAAAACATGAAGCTCAGAGAGG - Exonic
989631979 5:43494889-43494911 TGCAAAAAAGAAAACCAAAGTGG + Intronic
989908634 5:47299913-47299935 TTCCAACGAGGACCTCAAAGAGG - Intergenic
992424101 5:76638039-76638061 TCCTAACAAGAAGCTCAAACAGG - Intronic
992628477 5:78657291-78657313 TGCAAACCAAAACCACAATGAGG + Intronic
994567882 5:101475920-101475942 TGCAAACGAAAACCACAATGAGG + Intergenic
994780760 5:104087072-104087094 TGCAAACCAAAACCTCAATGAGG - Intergenic
996164379 5:120206902-120206924 TCCAAAAAGGAACCACAAAGAGG - Intergenic
996683153 5:126250343-126250365 TGTAACAAAGTACCTCAAAGTGG + Intergenic
998339756 5:141406462-141406484 TGAAAAATATAACCTCAAAGAGG - Intronic
998634959 5:143943120-143943142 AGCAAACAAGAACCTAAAGTGGG - Intergenic
999206855 5:149854888-149854910 TGTAAACAATAACCCCACAGTGG - Exonic
999313410 5:150568570-150568592 TGCAAATAATAACCACAATGTGG - Intergenic
999649123 5:153748382-153748404 TAGAAACAAGAAGATCAAAGTGG + Intronic
1000527426 5:162375289-162375311 TGTAAACAAGAGGCTCAAACTGG - Intergenic
1002379565 5:178816809-178816831 TGCAAAAAATCAACTCAAAGTGG + Intergenic
1002408710 5:179056246-179056268 TGCAAACAAGAATTTAAAAAGGG - Intergenic
1002410238 5:179069022-179069044 TGGAAACAAGATCTTTAAAGAGG - Intronic
1002873875 6:1193221-1193243 TGCATATAAGAACCTCAACTGGG - Intergenic
1003050150 6:2773083-2773105 TGCAATCAAGAACGGCTAAGCGG - Intronic
1003271819 6:4614131-4614153 AGGAAACAAGTTCCTCAAAGTGG - Intergenic
1005118704 6:22367070-22367092 TGCAAACAAGAAACAACAAGGGG - Intergenic
1005976501 6:30804125-30804147 TTCACACAAGAACCCCAGAGGGG - Intergenic
1006080847 6:31565455-31565477 GGGAAACAAGTGCCTCAAAGGGG + Intergenic
1006699361 6:35959246-35959268 TGAAAACCTGAACCTCAAGGGGG + Intronic
1007829054 6:44624486-44624508 TGCAAATGAGAACCTGAAGGAGG + Intergenic
1007869096 6:45012612-45012634 AGCAGACAAAAACATCAAAGGGG - Intronic
1007993763 6:46284439-46284461 TGCAAACATGAACTCCAAAATGG + Intronic
1008679184 6:53854186-53854208 TGCAAAGAAGAACTTCAAAGAGG - Intronic
1008728736 6:54453794-54453816 ACCAGACAAGAACCACAAAGGGG + Intergenic
1009065638 6:58558249-58558271 TTCCAACGAGGACCTCAAAGAGG - Intergenic
1009081816 6:58783906-58783928 TTCCAACGAGGACCTCAAAGAGG - Intergenic
1009132242 6:59485589-59485611 TTCCAACGAGGACCTCAAAGAGG - Intergenic
1009144351 6:59653700-59653722 TTCCAACGAGGACCTCAAAGAGG - Intergenic
1009152031 6:59760678-59760700 TTCCAACGAGGACCTCAAAGAGG - Intergenic
1009152249 6:59763735-59763757 TTCCAACGAGGACCTCAAAGAGG - Intergenic
1009157194 6:60233298-60233320 TTCCAACAAAAACCTCAAAGAGG - Intergenic
1009157441 6:60239084-60239106 TTCCAACAAAAGCCTCAAAGAGG - Intergenic
1009271946 6:61624863-61624885 TGCAGACTAGGACCTCCAAGTGG - Intergenic
1010027488 6:71236784-71236806 TGCAAAACAGAATTTCAAAGCGG - Intergenic
1011427696 6:87248585-87248607 AACAAACAAAAACCTGAAAGGGG + Intronic
1012161665 6:95892064-95892086 AACAAACAAGAACCACAAACTGG + Intergenic
1017541748 6:155409611-155409633 TGAATTCAACAACCTCAAAGTGG - Intronic
1017979045 6:159382670-159382692 TACAAACAAGAAAGTCAAACTGG + Intergenic
1018565020 6:165142452-165142474 TGCAAATCAAAACCACAAAGAGG + Intergenic
1019313320 7:373284-373306 TGCAGCCAAGCAGCTCAAAGGGG + Intergenic
1019884217 7:3889987-3890009 TGCAACCAAGAACCTCTGACTGG + Intronic
1023235994 7:38087985-38088007 TGCAAAAAATTAACTCAAAGTGG - Intergenic
1024835460 7:53513075-53513097 TGGACACAAGAACCTGGAAGAGG + Intergenic
1024998809 7:55296372-55296394 AGCCAATAAGAACCTCAAATGGG + Intergenic
1028311844 7:89348148-89348170 TGCATAGAACAACCTCTAAGAGG - Intergenic
1029352317 7:100022933-100022955 TGCAAACAGAAACCTCAAACAGG - Intronic
1030493519 7:110268257-110268279 TGCAACCAACAATCTTAAAGAGG - Intergenic
1030837479 7:114307532-114307554 TACAAACATGTAACTCAAAGGGG + Intronic
1032018863 7:128395585-128395607 TGCAAACAAAAGCCTTGAAGGGG - Intronic
1032018875 7:128395638-128395660 TGCAAACCAGTATCCCAAAGGGG - Intronic
1032661725 7:133991129-133991151 TGCAAATAAAAACCACAAGGGGG - Intronic
1033045053 7:137954419-137954441 AGCAAACAGGAACCTCTGAGAGG - Intronic
1033535213 7:142306096-142306118 TGCCGACAAGAAAGTCAAAGAGG - Intergenic
1034711311 7:153193744-153193766 TGCAAACTAAAACCACAATGAGG + Intergenic
1035242893 7:157543677-157543699 TACAAATAGGAACCTTAAAGAGG + Intronic
1035341774 7:158166897-158166919 AGCAAACAAGAAACACCAAGCGG + Intronic
1036107513 8:5856654-5856676 TACACAGAAGAACCTCAAAAAGG - Intergenic
1039536162 8:38315260-38315282 GGAAAAAAAGAACCACAAAGAGG + Intronic
1039625941 8:39053047-39053069 TGCAAATTAAAACCTCAATGAGG - Intronic
1039629692 8:39097210-39097232 TGCAGAAAAAAACCTCACAGAGG - Intronic
1040143130 8:43950788-43950810 TTCAAACGAAGACCTCAAAGAGG - Intergenic
1041014195 8:53574421-53574443 TACAAAAAAAAAACTCAAAGAGG + Intergenic
1041471851 8:58218964-58218986 TACAAAAAAGAACTTTAAAGAGG + Intergenic
1041589925 8:59566463-59566485 TGCAAATCAGAACCACAATGTGG + Intergenic
1042156781 8:65852405-65852427 TGCAACAAAGTACCACAAAGTGG - Intergenic
1042179021 8:66066157-66066179 TGCAAACTAAAACCACAATGAGG + Intronic
1042652216 8:71055552-71055574 TTCAAAGGAGAACATCAAAGAGG - Intergenic
1043362770 8:79494815-79494837 AGCAAACAAAAACATAAAAGTGG - Intergenic
1043654951 8:82651551-82651573 TGGAAACATAATCCTCAAAGTGG - Intergenic
1044501217 8:92960533-92960555 TTCAATGAAGAACCTCAAAATGG + Intronic
1045283341 8:100768820-100768842 TGCAAACCAAAACCACAATGAGG + Intergenic
1045728834 8:105210089-105210111 TGCAAATCAGAACCACAATGAGG + Intronic
1046442457 8:114275951-114275973 TACAAACAAAAATATCAAAGAGG + Intergenic
1049675847 8:143888725-143888747 CGCAAGCAAGCACCACAAAGTGG - Intergenic
1049862287 8:144907684-144907706 TGCAAATAAAAACCACAATGAGG - Intergenic
1050568741 9:6915441-6915463 TGTAACCCCGAACCTCAAAGTGG - Intronic
1050857175 9:10374122-10374144 TGCAAAGAGGACCCTCAAAAGGG - Intronic
1051514957 9:17920034-17920056 TGCAAACAAAAATCACAATGAGG - Intergenic
1052559986 9:30072996-30073018 TGCAAAAAGTAACTTCAAAGCGG + Intergenic
1055836626 9:80450694-80450716 TGAAAACAAAAACTTAAAAGAGG + Intergenic
1056015519 9:82382381-82382403 TGCAAATATGAGACTCAAAGTGG + Intergenic
1056053517 9:82795908-82795930 TGCAAATAAAAACCACAATGAGG + Intergenic
1056121065 9:83489535-83489557 TGCAAATAAAAACCACAATGAGG + Intronic
1057062029 9:92012844-92012866 TGTAAACAAGGCCCTTAAAGAGG + Intergenic
1057471297 9:95359291-95359313 TGCAAATAAAAACCACAATGAGG + Intergenic
1058367202 9:104222704-104222726 TGTGAAAAAGAACTTCAAAGAGG - Intergenic
1059870914 9:118575039-118575061 TGCAGACATGAACATCAAAATGG - Intergenic
1185866270 X:3627053-3627075 TGCAAATCAAAACCTCAATGAGG + Intronic
1188278457 X:28232284-28232306 TGCAAACCAAAACCACAATGAGG - Intergenic
1188596137 X:31902830-31902852 AGCAAACAAAAATCTTAAAGGGG - Intronic
1188638017 X:32460152-32460174 TGCAAACCAAAACCACAATGAGG + Intronic
1189261596 X:39682816-39682838 TGAAAATAAGAACCTATAAGAGG + Intergenic
1190574527 X:51819517-51819539 TGCAAATAAGAACCTCAATCAGG - Intronic
1190920540 X:54847514-54847536 TGCAAACCAAAACCACAATGAGG + Intergenic
1191203317 X:57807880-57807902 TGCAATAAAAAACGTCAAAGGGG - Intergenic
1191565610 X:62524045-62524067 TTCAAACAAAGGCCTCAAAGCGG + Intergenic
1193162966 X:78248824-78248846 TGCAAACTAAAACCACAACGAGG - Intergenic
1193989599 X:88290033-88290055 AGCAAACAAAAACATAAAAGTGG + Intergenic
1195805575 X:108761671-108761693 TGCAAATCAAAACCTCAATGAGG - Intergenic
1196779649 X:119372106-119372128 TGCAAACCAAAACCACAATGAGG - Intergenic
1197041813 X:121945457-121945479 TGCAAAGCAGTACCACAAAGTGG + Intergenic
1197351474 X:125388203-125388225 AGCCGATAAGAACCTCAAAGGGG + Intergenic
1197652345 X:129079079-129079101 TGGCAAGAAGAACCTCAATGAGG + Intergenic
1199052153 X:143248701-143248723 TGCAAATCAAAACCACAAAGAGG + Intergenic
1199660306 X:150042926-150042948 TGCAAATAAAAACTTCAATGAGG - Intergenic
1201945418 Y:19504998-19505020 TGCAAACAACAACAACAAAAGGG + Intergenic