ID: 1099473206

View in Genome Browser
Species Human (GRCh38)
Location 12:83075560-83075582
Sequence GTGAATAAACCTAAGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099473206_1099473210 30 Left 1099473206 12:83075560-83075582 CCTTTGATCTTAGGTTTATTCAC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1099473210 12:83075613-83075635 TTCTACTTCAGTTCATAGATAGG 0: 1
1: 0
2: 0
3: 20
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099473206 Original CRISPR GTGAATAAACCTAAGATCAA AGG (reversed) Intronic
900007225 1:68812-68834 AGGAATAAACCTAACATTAATGG + Intergenic
904050864 1:27637447-27637469 GTGAATCAACCAAAGGACAAAGG + Intergenic
904757540 1:32776571-32776593 GAAAATAAACCTAAGTGCAAAGG + Intronic
904900463 1:33853159-33853181 GAGAACAAACCCATGATCAAAGG - Intronic
906461511 1:46037992-46038014 GTAATTCACCCTAAGATCAATGG + Intergenic
906657606 1:47560031-47560053 GTGCATAAACCAAAGCTCCAAGG + Intergenic
910297660 1:85666897-85666919 GAGAATAAAACAAAGAACAAAGG - Intronic
912971368 1:114286801-114286823 GTGTATAGACCTAAGATCAAGGG - Intergenic
915452044 1:156012501-156012523 GTTAATAGACATAAAATCAAAGG - Intronic
921573260 1:216803662-216803684 GTGAGTACAGCTAAGACCAAAGG - Intronic
1063847729 10:10149850-10149872 GTGACTGAGGCTAAGATCAAGGG - Intergenic
1068235627 10:54229072-54229094 GCAAATAAACCTGAGATTAAAGG + Intronic
1070853526 10:79586427-79586449 GTAAATACACCTAGGAGCAAAGG + Intergenic
1071398482 10:85246125-85246147 GTCAACAAAGCTAAGATCTAAGG + Intergenic
1071415394 10:85436536-85436558 GTGAAAAAGACTAAGATCATAGG - Intergenic
1071892454 10:90025744-90025766 GTGAATGAACACAAGATAAATGG + Intergenic
1073788330 10:106914534-106914556 GTGAAATAAACTGAGATCAATGG + Intronic
1074367832 10:112874302-112874324 GTGAAAAAGCCTAAGATAACTGG - Intergenic
1078630243 11:12996088-12996110 TGGAATTAACCTAACATCAATGG - Intergenic
1079778744 11:24570413-24570435 ATAAATAAACCTATGATAAATGG - Intronic
1082709269 11:56533709-56533731 GTGCATGAACCTAAGTTCTAGGG + Intergenic
1088679963 11:112231219-112231241 GTGTCTAAATCTATGATCAAAGG - Intronic
1099473206 12:83075560-83075582 GTGAATAAACCTAAGATCAAAGG - Intronic
1100863898 12:98835241-98835263 GTGAGAAAACCTGAGATCAGAGG - Intronic
1103109067 12:118258948-118258970 GTGAATAAAGCTAAGTGCTATGG + Intronic
1104203225 12:126612427-126612449 GTGAAGAAACCCTGGATCAATGG - Intergenic
1107004924 13:35598769-35598791 TAGAATAAAGCTAAAATCAAGGG - Intronic
1107124298 13:36829686-36829708 GTAAATAAACTCAAGCTCAATGG - Intergenic
1107792737 13:44018357-44018379 GTGAATAAGCCAGAAATCAAAGG + Intergenic
1109210980 13:59535868-59535890 GACAATAAACCTACTATCAATGG - Intergenic
1110082015 13:71325750-71325772 GTTAATGAATCTAGGATCAAAGG - Intergenic
1110504641 13:76271448-76271470 TTGAACAAACCTAAGAGCAATGG + Intergenic
1111039734 13:82731046-82731068 TTGAATAAACCTGAGGACAATGG - Intergenic
1111052699 13:82906056-82906078 GTGAATACACTTAAGGTCACAGG + Intergenic
1112720853 13:102242939-102242961 ATGACTAAACCTAAAAGCAAAGG - Intronic
1114943953 14:27654673-27654695 GTGACCAAACCTAATTTCAAAGG - Intergenic
1117923101 14:60746134-60746156 GTGAACAAACCAAAGTTAAATGG - Intronic
1119175144 14:72563285-72563307 GGGAATAAACCAAGGAGCAAGGG - Intronic
1121096838 14:91223310-91223332 TTCAATAAACCTTTGATCAATGG + Intronic
1123104087 14:105829521-105829543 ATGAACAAACCTAAGATAATTGG - Intergenic
1124219719 15:27839203-27839225 GTGAAAAAGCATAAGAACAAAGG + Intronic
1125119490 15:36137615-36137637 GTGAAGACAACTAAGATAAAGGG - Intergenic
1127684242 15:61326252-61326274 GTGACTAGACCTGAGAGCAATGG - Intergenic
1132446329 15:101923316-101923338 AGGAATAAACCTAACATTAATGG - Intergenic
1137566468 16:49535884-49535906 GTTAATAATCCTCAGATTAATGG + Intronic
1138797836 16:59992182-59992204 ATGACTAAACCTAAGAATAATGG - Intergenic
1139492421 16:67293507-67293529 GTGAATAAGACTTAGATCAAAGG + Intronic
1140906163 16:79411072-79411094 GTGAATAAAGGCAAGATCAAAGG - Intergenic
1143094517 17:4470735-4470757 TTGAATAAACGTAAAATCAAAGG + Intronic
1145067925 17:19775457-19775479 TTTAATAAACCTAAGGTCACAGG + Exonic
1146386325 17:32378362-32378384 ATGAATCAACCTAAGAAAAAAGG + Exonic
1148044674 17:44735894-44735916 GTAAATAAATGTAAGATAAATGG - Intronic
1155108615 18:22691531-22691553 TTGAATTATCCTAAGATGAAAGG - Intergenic
1155327527 18:24680299-24680321 TTGGATAAACCAAATATCAAAGG - Intergenic
1158210206 18:55040551-55040573 GGAAATAAACCTCAGAACAAAGG + Intergenic
1158304669 18:56091923-56091945 GGTAAAAAACATAAGATCAATGG - Intergenic
1158415927 18:57249774-57249796 CTGAATAAACATAACACCAAAGG - Intergenic
1159856510 18:73596120-73596142 CTGAATAAAGTTAAGATTAAGGG + Intergenic
1160638979 19:110400-110422 AGGAATAAACCTAACATTAATGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
925148037 2:1594052-1594074 GTGACAAAACCTCAGTTCAAAGG - Intergenic
925615096 2:5737627-5737649 GTGATTAAACCGAATATTAAAGG + Intergenic
926959080 2:18333821-18333843 GAGAATAAAGCTAAGATCCAGGG - Intronic
927129379 2:20045045-20045067 GTGAATATCTTTAAGATCAAAGG - Intronic
932553039 2:72791604-72791626 ATAAATAAATTTAAGATCAAGGG + Intronic
933929588 2:87135451-87135473 GAGGATAAAACTAAGATGAAAGG - Intergenic
934000920 2:87711243-87711265 GAGGATAAAACTAAGATGAAAGG - Intergenic
936363347 2:111827928-111827950 GAGGATAAAACTAAGATGAAAGG + Intronic
938450623 2:131415870-131415892 GTGAAAACACATATGATCAAGGG + Intergenic
941087623 2:161135783-161135805 CTGAATAAACTTATGATTAAAGG - Intergenic
941141648 2:161790241-161790263 GGGAATAAATCTTAGTTCAATGG - Intronic
941913149 2:170786380-170786402 ATGAATAAAGATAAGAACAACGG - Intronic
942237718 2:173928331-173928353 GTGTATAAAACTAATATTAATGG - Intronic
942667570 2:178336569-178336591 GTGCATAAAAATAAGAACAAGGG - Intronic
942815516 2:180048983-180049005 GTAAATAAAACAAAGAGCAAAGG - Intergenic
945348113 2:208743860-208743882 GTGAATAAAACTGTGTTCAAAGG + Intronic
946138597 2:217668719-217668741 GTCAGTAAACCTATGATCATGGG - Intronic
947147303 2:227080122-227080144 CTGAATACACCTAAAATCAGTGG + Intronic
1169719083 20:8653042-8653064 GTTAATAAGCCTTAAATCAAGGG - Intronic
1170425376 20:16229969-16229991 GTAAATAAACCTGAAATCTATGG - Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1175044550 20:56092907-56092929 TTGTATTAACCTCAGATCAAAGG - Intergenic
952801229 3:37294074-37294096 GTGACTATACCTAAAATGAACGG + Intronic
953393568 3:42548659-42548681 TGGAATAAACCAAACATCAATGG + Intronic
954486065 3:50852175-50852197 GTGAAGAAACCTCAGATCCCAGG - Intronic
957491659 3:80934835-80934857 CTGAATAAACCTACGTTAAATGG - Intergenic
957541560 3:81576927-81576949 GTGAATAATTCAAAGATCCAGGG + Intronic
957833303 3:85551468-85551490 GTGAATCACCATATGATCAAAGG - Intronic
959805890 3:110553291-110553313 GTAGATAAAGCAAAGATCAATGG - Intergenic
959812827 3:110638899-110638921 GTGAATAAAGCAAAAATCATAGG - Intergenic
960155001 3:114290726-114290748 GTTAATAAGCCTCAGATCACGGG + Intronic
961556576 3:127700368-127700390 GTTAATTAAGCTAAGAGCAAGGG - Intronic
964532435 3:157682916-157682938 GTTAAAAAACCTAAGACCAAGGG - Intergenic
964609472 3:158595938-158595960 GTGATAAAACCTAAAATCAGTGG + Intronic
965985682 3:174750357-174750379 GAGAATAAAGCCAAGATCCATGG - Intronic
967114490 3:186324299-186324321 ATGAAGAAACCAAAGTTCAAGGG - Intronic
970649126 4:18158221-18158243 GTGACTAAACCCAAAATAAAGGG - Intergenic
974733057 4:65895617-65895639 TTGAAGAAACCAAAAATCAATGG - Intergenic
974900574 4:67992048-67992070 GTGAATAAAGCTAAGATTTCAGG + Intergenic
977130969 4:93236512-93236534 GTAAATAAACCCAGGATCTATGG - Intronic
980114978 4:128670639-128670661 GTGACCAAATCTAAGTTCAAGGG + Intergenic
986002752 5:3643011-3643033 GAGATTAAACCTATGATGAAGGG + Intergenic
986595926 5:9421740-9421762 TTGAATTATCCTAAGAGCAATGG + Intronic
986894808 5:12352437-12352459 GTGCATAAACCTAAGAGAACTGG + Intergenic
987258576 5:16180622-16180644 GTGAGTAAAACTAAGATCCGGGG - Intronic
989179615 5:38563488-38563510 GTGAAGAGACCAAAGCTCAAAGG + Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
992847583 5:80767527-80767549 ATGAATAATCCAAAGAACAATGG - Intronic
993515100 5:88822440-88822462 GTGAATAATACTAAGATTTATGG - Intronic
993628266 5:90252146-90252168 GTGAACAGAGCTAATATCAATGG - Intergenic
993978143 5:94507921-94507943 GTGAATATCACTAAGATCAGAGG - Intronic
995801640 5:116002681-116002703 GTGAGTAATCCTAAGAGCAAAGG + Intronic
995848545 5:116520596-116520618 GAGGGTAGACCTAAGATCAATGG + Intronic
996734527 5:126746666-126746688 GTTACTAAACCTAAGAGGAAAGG - Intergenic
997858812 5:137397520-137397542 ATGAATAAACCTGACATCCAGGG - Intronic
998378117 5:141704675-141704697 TTGTACAAACCTAAGAACAATGG + Intergenic
1001224367 5:169931128-169931150 ATGCTTAATCCTAAGATCAAGGG - Intronic
1001854735 5:175000960-175000982 GTGAAGAGGCCAAAGATCAAAGG - Intergenic
1005599941 6:27416376-27416398 ATGAATAAACCTAAATTGAAAGG + Intergenic
1007062513 6:38954811-38954833 CTGAATAAACCAATAATCAAGGG + Intronic
1008474716 6:51923590-51923612 GTTGATAAACATAAAATCAAAGG + Intronic
1008708702 6:54196764-54196786 GTGAATAAACCGAAGATCTCTGG + Intronic
1010970356 6:82256345-82256367 ATCAATAAAACTAAGATCTAGGG + Intergenic
1011001889 6:82599488-82599510 TTGAATAAACATAAGCACAAAGG + Intergenic
1011793622 6:90927934-90927956 GAGAATAAGTCTAAGACCAAGGG + Intergenic
1012668051 6:102003214-102003236 ATGAATAAACATAGGATAAATGG - Intronic
1012794496 6:103742502-103742524 CTGAATAGACCTAAAATAAAAGG + Intergenic
1014094649 6:117446687-117446709 GAAAATTAACCTAAGATCAAAGG - Intronic
1016480160 6:144472038-144472060 GTAAATGACCCTGAGATCAAGGG - Intronic
1017251582 6:152285692-152285714 GACAATTAACCTAAGAGCAAAGG - Intronic
1018524509 6:164693813-164693835 GTGTGTGAACCTAAGATCATGGG - Intergenic
1019887058 7:3914449-3914471 ATGAGAAAACCTAAGATTAACGG + Intronic
1021077564 7:16323357-16323379 ATGACCAAACCTAAAATCAAGGG - Intronic
1021827225 7:24567281-24567303 GTGATTAAACATAAAAACAAAGG - Intergenic
1022166382 7:27767334-27767356 GTAAATAAAAGTAAAATCAAAGG - Intronic
1022705355 7:32796940-32796962 GTGAATACTCTAAAGATCAATGG - Intergenic
1027691518 7:81352818-81352840 TTGAATAAACTTAAGGTAAAGGG - Intergenic
1031510719 7:122646002-122646024 GTGAATAATGCTGAGATTAAAGG + Intronic
1033272468 7:139944957-139944979 GTGAATAAACTAAGGAGCAAAGG + Intronic
1037186535 8:16070632-16070654 GTCAATATACCAAAAATCAATGG + Intergenic
1037286701 8:17309279-17309301 GTGATTAAACTTATGACCAAAGG + Exonic
1040700682 8:50060636-50060658 GTGAGAAACCCTAAGATCAGAGG - Intronic
1041201793 8:55456753-55456775 TTGAATAAACATAGCATCAAAGG + Intronic
1043361057 8:79472650-79472672 GTGAGTAAAGCTAAGATCTAAGG + Intergenic
1046817519 8:118600840-118600862 GTGAATAATCCTTAAAGCAAAGG - Intronic
1048033612 8:130655950-130655972 ATGAATAGAACTAAGATCATGGG - Intergenic
1048065814 8:130967433-130967455 ATGAAGAAACCAAAGCTCAAAGG - Intronic
1048910569 8:139130867-139130889 GTGTAAAAAGCTAAGAGCAATGG - Intergenic
1050810190 9:9735780-9735802 GTTAATAGAACTAAGATCCATGG - Intronic
1052681333 9:31697117-31697139 GTGAATGAAACTAAGAAGAATGG - Intergenic
1053587474 9:39475151-39475173 GTGAATAAAACTGAAATAAATGG + Intergenic
1054578825 9:66890085-66890107 GTGAATAAAACTGAAATAAATGG - Intronic
1054875158 9:70088266-70088288 GTGAAGAAAGGTAAGAACAATGG + Intronic
1055874883 9:80930305-80930327 GAGAATAAATGTAAGATAAATGG - Intergenic
1189387458 X:40549103-40549125 GTTAATAGGCCAAAGATCAAGGG + Intergenic
1194299269 X:92164560-92164582 GTGAATAAAATTAAAAACAAAGG + Intronic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1196987475 X:121290920-121290942 CGGTATAAACCAAAGATCAAAGG - Intergenic
1200616873 Y:5389394-5389416 GTGAATAAAATTCAGAACAAAGG + Intronic