ID: 1099473296

View in Genome Browser
Species Human (GRCh38)
Location 12:83076773-83076795
Sequence AGGGAGAATTAGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 750
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 701}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099473296 Original CRISPR AGGGAGAATTAGAAGCAGGA GGG (reversed) Intronic
900254492 1:1690906-1690928 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900263243 1:1744181-1744203 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900913195 1:5616767-5616789 AGGGGGAAATAGCAGCAGGGAGG + Intergenic
901637299 1:10676255-10676277 AGAGGGAATGAGAAGCAGCATGG - Intronic
901784429 1:11615412-11615434 AGAGAGGATTTGAGGCAGGAGGG + Intergenic
902151530 1:14447164-14447186 AGGGAGAACTAGAAGAATTATGG - Intergenic
902696366 1:18143426-18143448 ATGGAGAGTTCTAAGCAGGAGGG - Intronic
904172397 1:28600424-28600446 AGGTGGAATTGGAAGCAGGCAGG - Intronic
904366156 1:30012078-30012100 AGAGAGAACTTGAAGCAGGGAGG + Intergenic
904624722 1:31796025-31796047 AGGGAGAGGAAGGAGCAGGATGG + Intronic
904652015 1:32013267-32013289 AGGGAGAAATTGAGGAAGGACGG - Intergenic
904809550 1:33154421-33154443 AGAGAGAATGAGAAGCTGGCAGG - Intronic
904893852 1:33799508-33799530 AGGGAGAAATAAATGGAGGAAGG - Intronic
905035247 1:34913990-34914012 AGGGAGAATAAGAAGGAAAAAGG + Intronic
905265549 1:36752304-36752326 AGGGAGAATGAGAAGAACCAAGG - Intergenic
905452436 1:38065286-38065308 AGGGAGAAGTCGTAGTAGGAGGG + Intergenic
905520899 1:38598938-38598960 AGGGAGAGGTGGAGGCAGGAGGG - Intergenic
905703696 1:40038916-40038938 AGAGAGAAGAGGAAGCAGGAAGG - Intergenic
906073242 1:43032993-43033015 AAGTAGAATTAGCAGTAGGATGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906456503 1:46001778-46001800 AGGGAGAAGAAGAAGCAAAAAGG - Intronic
907238023 1:53064591-53064613 AGGTAGGACTAGAAGAAGGAAGG - Intronic
907593542 1:55698908-55698930 AGGGAGAGTTAAAACCAGGCAGG - Intergenic
908702613 1:66919035-66919057 AGGGACAACTTGAAGCAGGGAGG - Intronic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909925642 1:81434628-81434650 AGGGAGGATTACAAACAGGGAGG + Intronic
910051954 1:82985238-82985260 AGAGAGAATGAAACGCAGGAGGG - Intergenic
911945747 1:104106615-104106637 TGGGAGAAAAAGAAGCAGGATGG - Intergenic
912449668 1:109761214-109761236 AGGAAGAAGTAGCAGCAGGATGG - Intronic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
913717912 1:121557203-121557225 ATTGAGGAATAGAAGCAGGAAGG - Intergenic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915080435 1:153348396-153348418 AGGGAGATATAGGAGTAGGAGGG + Intronic
915434438 1:155893073-155893095 TGGGAGAATGAGAAGGAGTAAGG - Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916654118 1:166858259-166858281 AGGGAGCAGTAAAAGCTGGAGGG + Exonic
916843304 1:168622880-168622902 AGGGAAAATTTGAAGAAAGAGGG - Intergenic
917105259 1:171485531-171485553 AGCGAGAAAAAGAAGCAAGATGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917374956 1:174341462-174341484 AGAGAATATTAGAAGTAGGAGGG + Intronic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
917965688 1:180177108-180177130 ATTGAGAAATAGAAGCAGCAAGG - Intronic
918070436 1:181130253-181130275 AGGGACATTTTGAGGCAGGATGG - Intergenic
918197346 1:182234695-182234717 AGGGAGAAAGCGAAGCAGGGAGG - Intergenic
918623451 1:186631733-186631755 AGGGAGGATTAAAAGAAAGAAGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920089548 1:203442511-203442533 AGAGAGGAATAGAAGGAGGAAGG - Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920278607 1:204826998-204827020 GGGAAGAAAAAGAAGCAGGAAGG + Intergenic
920712648 1:208309876-208309898 AGAGATAAATAGAACCAGGAAGG + Intergenic
921219230 1:212961468-212961490 AGGGAGAAAGAGAAGCAGAAGGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921990219 1:221358031-221358053 TGTGTGAGTTAGAAGCAGGATGG + Intergenic
922040437 1:221891035-221891057 AGGGAGGCTGAGAAGCATGAGGG - Intergenic
922416347 1:225426863-225426885 AGGGAGAAGAACGAGCAGGAGGG - Intronic
922722687 1:227906646-227906668 AGGGAGAGGGAGGAGCAGGAAGG - Intergenic
923410200 1:233700571-233700593 AGAGAAAATTAGAAACAGCAGGG - Intergenic
923696316 1:236255682-236255704 AGGGAGATTTAGAGGCAGTGGGG + Intronic
923703958 1:236327951-236327973 AGAGAGAATTAGAAGAATGGAGG + Intergenic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
1063225639 10:4013027-4013049 AGGGAGAAAGAAAAGAAGGAAGG - Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064317819 10:14274659-14274681 AGGGAGAATTGGAAAAATGAAGG + Intronic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064850841 10:19707058-19707080 AGGGAGAAGTAGAAGAAAGGAGG - Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066355603 10:34680583-34680605 AAGGGGAATGAGAAGCGGGAGGG + Intronic
1067251861 10:44593358-44593380 AGGGAGGGAAAGAAGCAGGAAGG + Intergenic
1067728891 10:48794642-48794664 AAGGAGATTGAGAAGCAAGAGGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069211624 10:65768636-65768658 AGAGAGAAGTAGCAGCAGGCAGG - Intergenic
1069880109 10:71587197-71587219 TGTGAGTTTTAGAAGCAGGAAGG - Intronic
1070367774 10:75752675-75752697 AGGGAGAGTTAGAAACAGCTAGG + Intronic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071702965 10:87962055-87962077 AGGTAGAATAAGAAATAGGAAGG - Intronic
1071923032 10:90372971-90372993 ATGGAGATTTAAAAGCAGGGAGG + Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072895949 10:99366837-99366859 AGAAAGAACTAGAAACAGGAAGG - Intronic
1072918144 10:99553062-99553084 AGGGAGAAATAGGAGTGGGAAGG - Intergenic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075164853 10:120058575-120058597 GGGGAAAATTAGTATCAGGAAGG + Intergenic
1075175347 10:120155554-120155576 AGGGAGAATTTGAGGCAGAGAGG - Intergenic
1075333999 10:121596285-121596307 AGGCAGAGTGACAAGCAGGAAGG + Intronic
1075593391 10:123708992-123709014 AGTGAGAACTAGAAGGAGCAGGG + Intronic
1076107095 10:127832261-127832283 AGGGAAAATGAGACACAGGAGGG + Intergenic
1077637602 11:3854660-3854682 TGGGAGAATGAGATGCAGGGAGG + Intronic
1078027271 11:7709060-7709082 AGGGAGAATGAGAAGCAGACAGG - Intergenic
1078200011 11:9172609-9172631 AGAGAGAATGAGTACCAGGAGGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078745751 11:14112821-14112843 TGGAAGAATTAGAAGGAGCAAGG - Intronic
1079392330 11:20033474-20033496 AGGAAGAATTTGGAACAGGATGG + Intronic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080217772 11:29865254-29865276 AGATAGAATGAGAAGAAGGAAGG - Intergenic
1080245621 11:30176717-30176739 AGAGAGAATGAGAACCAGCAGGG + Intergenic
1080585003 11:33674103-33674125 AGGTAGAATGAGAAACAGGCAGG - Intergenic
1081309827 11:41556235-41556257 ACAAAGAATTAGAGGCAGGAAGG + Intergenic
1081687608 11:45053710-45053732 AGGAAGAATTCAATGCAGGAGGG - Intergenic
1082784942 11:57311596-57311618 GGGGAGAAGGAGGAGCAGGAAGG - Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1082948180 11:58782404-58782426 AGAAAGAAATAGAAGGAGGATGG + Intergenic
1082979337 11:59105552-59105574 ATGGAGGATTTGAAGCAGGGGGG - Intergenic
1084555692 11:69874606-69874628 AGGGAGGTTTGGAAGCAGGTAGG - Intergenic
1084964351 11:72736664-72736686 AGAGAGAAGGAGAGGCAGGATGG - Intronic
1085127477 11:74011424-74011446 AGAGATAAATAGAAGCGGGAGGG + Intergenic
1086045388 11:82525914-82525936 AGGCAAAATTAGAAGTAGTAGGG + Intergenic
1086852268 11:91823397-91823419 AGGGAGGTTTGGAAGCAAGATGG + Intergenic
1087020283 11:93595840-93595862 GGGGAGAATTGGAGACAGGAGGG - Intergenic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1087474177 11:98617079-98617101 AGGGAGAAGTATAAGCAAGCAGG + Intergenic
1087539186 11:99493059-99493081 AGGTAGCAGTAGAAGCAGGAAGG - Intronic
1087691792 11:101329112-101329134 AGGAAGCATTTGAGGCAGGAAGG - Intergenic
1088381269 11:109195069-109195091 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1088447108 11:109943350-109943372 AGAGAGAAATAGCAGCAGCAAGG + Intergenic
1088673580 11:112167900-112167922 AGGGAAAATTAGAAGGGGAAGGG + Intronic
1088751858 11:112849093-112849115 AGGAAGAAATAAAAGAAGGAAGG - Intergenic
1088850409 11:113699448-113699470 AGGGTGAAATTGCAGCAGGAGGG - Intronic
1088922854 11:114274037-114274059 GGGGAGTGTTAGGAGCAGGAAGG - Intronic
1089269916 11:117295036-117295058 AAGGGGAATTAGCAGAAGGAGGG - Intronic
1089649881 11:119905802-119905824 AGGGAGAATGAGCAGCAAGCTGG + Intergenic
1089788082 11:120922394-120922416 AGGGAGCAAAAGCAGCAGGATGG - Intronic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090655114 11:128837259-128837281 AGGGATATTTAGAAGCAGATGGG + Intronic
1090990397 11:131812225-131812247 GGGGAGAATGAGAGGGAGGAAGG - Intronic
1091391578 12:129406-129428 AGGGAGAACAGGAAGCTGGAGGG - Intronic
1091427691 12:405597-405619 GGAGAGAATTAGAAGAAAGATGG + Intronic
1091689795 12:2588187-2588209 CGGGAGAACAAGAAGCAGGAAGG - Intronic
1092270494 12:7019290-7019312 AGTGAGAATGAAAAGCAGGGAGG - Intronic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093726897 12:22523442-22523464 ATGGGGAATTACATGCAGGAAGG + Exonic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096653232 12:53072481-53072503 AGGGACAATTCGAAGTGGGAGGG + Intronic
1096782148 12:53997671-53997693 GGGGAGAATTAAAAGAAGGAAGG - Intronic
1097046051 12:56188881-56188903 AGAGAGAATGGAAAGCAGGAGGG - Intronic
1097070446 12:56350716-56350738 AGGTAGGATTGGAAGGAGGAAGG + Intronic
1097958094 12:65506685-65506707 AGGGAGAACTAGGAGGAAGATGG + Intergenic
1097975082 12:65676822-65676844 AGGGAGAAATAATAGAAGGACGG + Intergenic
1098320785 12:69240517-69240539 AGGAAGAATTGGAAGCGCGATGG + Intronic
1098454547 12:70657263-70657285 AGGGTGAATTTGAAGGAGGCAGG + Intronic
1098819027 12:75207252-75207274 TGGGAGAAGTTGAAGCAGCAGGG + Intronic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1100244302 12:92741663-92741685 AGGGAGAATTAAAATCAAGTAGG - Intronic
1100522538 12:95389121-95389143 AGGGACAACTCGAAGCAGGGAGG - Intergenic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102194382 12:111014214-111014236 AGGGGGAATAAGAAGAAAGAGGG + Intergenic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102783824 12:115587770-115587792 AGGCTGAATGAGAAGCATGACGG - Intergenic
1102786174 12:115606763-115606785 AGGGAGAATAGGAAGAAAGATGG - Intergenic
1103003619 12:117404915-117404937 AGGGGGAAGTAGAACCACGAAGG + Intronic
1103040542 12:117691617-117691639 ATGGAGAACTGGAGGCAGGAGGG - Intronic
1103071709 12:117949759-117949781 AGGGAGAATTAGCTACATGATGG + Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104301697 12:127570410-127570432 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1105776522 13:23666806-23666828 AGGGAGACTTAGATGCAGGCAGG + Intronic
1106048036 13:26163697-26163719 AGGGAGATTTAGATGCAGGAGGG - Intronic
1106255613 13:28019772-28019794 AGGGAGGACCAGAAGCGGGAGGG - Intronic
1107106116 13:36644488-36644510 AGAGAGAATTTTAAGAAGGAGGG + Intergenic
1107318540 13:39160809-39160831 AGGGAGAAAGAGAGGTAGGAAGG + Intergenic
1107390054 13:39954303-39954325 AGGAAGTTTTAGAAGGAGGATGG - Intergenic
1107637722 13:42409438-42409460 ATGGAGAATTCCAAGCATGATGG - Intergenic
1107684262 13:42880916-42880938 AGGGATAATTATGAGAAGGAAGG + Intergenic
1107802849 13:44126610-44126632 AGGGAGAAGTACAAGAAAGAAGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108214778 13:48173445-48173467 AGGTAGAATTGAAAGAAGGAAGG + Intergenic
1108256205 13:48613375-48613397 AGGAAGAGTCAGAAACAGGAGGG + Intergenic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1110271477 13:73595833-73595855 AGGGAGATTGAGAAATAGGAAGG + Intergenic
1110810509 13:79807049-79807071 AGGGAGGATTTAGAGCAGGAAGG + Intergenic
1112488747 13:99843105-99843127 AGTGAGGACTTGAAGCAGGATGG + Intronic
1113082024 13:106530245-106530267 GGGGGGAATTAGAAGGAGGCTGG - Intronic
1113207736 13:107936837-107936859 AGGGAGAGTTAGTGGCAGAAAGG - Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1114377684 14:22166026-22166048 AATGAGAATGAAAAGCAGGAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115873810 14:37837899-37837921 AGAGAGAATTTTAAGAAGGAAGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116349231 14:43837898-43837920 ACGGAGATTTAGAATCATGAAGG - Intergenic
1116631159 14:47335802-47335824 AGACAAAATTTGAAGCAGGAAGG + Intronic
1116727798 14:48584199-48584221 AGTGGGAAGTAGAAACAGGATGG + Intergenic
1118425048 14:65651159-65651181 AGGGAGGATTAAAAAGAGGAGGG + Intronic
1118631983 14:67713839-67713861 AGGGACAACTCGAAGCAGGGAGG + Intronic
1119740668 14:77012007-77012029 GAGGAGAATGAGTAGCAGGAGGG - Intergenic
1120205766 14:81585841-81585863 AGGAAGACTTGGAAGCAGGGAGG - Intergenic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121697948 14:95928289-95928311 AGGGAGAGGGAGAAGCAGGGAGG - Intergenic
1122006064 14:98704806-98704828 AGGGAGAGCTGGAAGAAGGAGGG - Intergenic
1122307741 14:100776427-100776449 TGGGGGAATGAGAAGCAGGAGGG + Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1123168223 14:106346890-106346912 AGTGAGAATTAAAAGAAGAATGG - Intergenic
1123222478 14:106870154-106870176 AGTGAGAATTAAAAGGAGAATGG - Intergenic
1202940873 14_KI270725v1_random:143889-143911 AGGGAAGAATAGAGGCAGGAAGG + Intergenic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1126063639 15:44808268-44808290 TGGAAGAATTAAAAGCAGAAAGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1128720752 15:69946636-69946658 AGGTAGAATAAGAATCAAGAAGG + Intergenic
1129373303 15:75111235-75111257 GGGGAGAAGTGGAAGCATGAAGG + Intronic
1130654486 15:85782520-85782542 AGGGAGAATGAGAGGAAGGGAGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131575675 15:93588280-93588302 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1131575682 15:93588324-93588346 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1131726914 15:95236179-95236201 AGCTAGAATTAGATCCAGGAAGG + Intergenic
1132072571 15:98791878-98791900 GGGAAGAAATAGAAGAAGGAAGG + Intronic
1133821769 16:9243478-9243500 AAGGAGAATTCGGAGCAGAAAGG - Intergenic
1134216351 16:12319808-12319830 ATGGAGACTTCAAAGCAGGAAGG + Intronic
1134455295 16:14390898-14390920 AGGGACACTGAGAAGCAGGGAGG + Intergenic
1135069462 16:19339413-19339435 AGGGAGAATTAGAGGTTGTAGGG - Intergenic
1135875664 16:26197830-26197852 TGGGAGACTTTTAAGCAGGAAGG - Intergenic
1137353974 16:47740294-47740316 TGGGAGAAATAGCAGAAGGAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138005080 16:53326817-53326839 GGGTAGAATTAGAGGGAGGAAGG - Exonic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139646420 16:68334421-68334443 AGGGAGAGTTTCAAGAAGGAAGG - Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140997166 16:80272256-80272278 AGAGAGAATGAGAGCCAGGAGGG + Intergenic
1141028662 16:80570047-80570069 AGAGAGAATGAAAAGAAGGAAGG - Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141373412 16:83508042-83508064 AGAGAGAAAGAGAAGAAGGAAGG + Intronic
1141411643 16:83838262-83838284 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1142918916 17:3167329-3167351 AGAGAGAAATAGAGGAAGGAAGG - Intergenic
1143055442 17:4158685-4158707 TTGGAGAACTAGAAGCAGCATGG - Intronic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143890731 17:10100449-10100471 AGGCAGAGATGGAAGCAGGATGG - Intronic
1144155659 17:12498101-12498123 AGTAAGTATTAGGAGCAGGAGGG - Intergenic
1144417030 17:15058267-15058289 AGTGAAAATTAGAAGTATGAAGG + Intergenic
1144622559 17:16827333-16827355 AGGGAAAAATAAAAACAGGAAGG + Intergenic
1145104935 17:20107052-20107074 TGGGAGGATGAGAATCAGGAAGG + Intronic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1145722037 17:27082611-27082633 AGGGGGCACTGGAAGCAGGAGGG + Intergenic
1146473635 17:33144437-33144459 TGGAAGACTTGGAAGCAGGATGG - Intronic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147119371 17:38326914-38326936 AGGCAGCATGGGAAGCAGGATGG - Exonic
1147576898 17:41607258-41607280 AGGGAAAAATAAAAACAGGAAGG + Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148767864 17:50049683-50049705 AGGGAGAGTTGGAGGCAGGGAGG + Intergenic
1149128309 17:53262906-53262928 TGGGAGAAATGGAAGAAGGAAGG + Intergenic
1150771996 17:68050193-68050215 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150772007 17:68050257-68050279 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1151279933 17:73065882-73065904 AGGGAGGCTCAGAGGCAGGACGG + Intronic
1151447430 17:74176428-74176450 AAGGAGGATGAGAGGCAGGAAGG + Intergenic
1151742449 17:75992932-75992954 AGTAAGAATCAGAAGCAGGCAGG - Intronic
1151895322 17:76976574-76976596 AGGGACAAGAAGAAGCAAGATGG + Intergenic
1153606335 18:6837197-6837219 AAGGAGAACTTGAAGCAGAATGG + Exonic
1154106045 18:11523898-11523920 AGGGTGAGTTGGAGGCAGGAAGG - Intergenic
1154508149 18:15062649-15062671 AGGGAGGGTTAGAAGCATTATGG + Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155416069 18:25601236-25601258 AGGAAAGAGTAGAAGCAGGAAGG - Intergenic
1155610384 18:27660598-27660620 AGAAAGCAGTAGAAGCAGGAAGG - Intergenic
1155792477 18:29991195-29991217 AGTGAGAATTAGAAACAGAGAGG - Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156549879 18:38004358-38004380 AGGGAGCATTGGCAGCAGCATGG - Intergenic
1156562839 18:38148108-38148130 AGGAAGAATTTGAGGAAGGAGGG + Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156950472 18:42890578-42890600 AGAGAGAAGGAGAAGCAGGGAGG + Intronic
1157177008 18:45460868-45460890 AGTGTGACTTAGAAGCTGGAAGG + Intronic
1157420981 18:47547243-47547265 ATGGGGAATTAGATGCAAGATGG + Intergenic
1157431153 18:47627582-47627604 AGGGAGAAGTCGGATCAGGAGGG - Intergenic
1157567926 18:48692424-48692446 TGGGAGAATTAGAGGCAGAGAGG - Intronic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1158492769 18:57925160-57925182 AATGGGAATTAGAACCAGGAGGG + Intergenic
1159213344 18:65358838-65358860 AAGGAGATTTAGAGGCAAGAGGG + Intergenic
1159448618 18:68571675-68571697 AGGAAGAAATAGAGCCAGGAAGG + Intergenic
1159598866 18:70409848-70409870 AGGCAGGATTGGAGGCAGGATGG - Intergenic
1160566814 18:79791018-79791040 AGGGAGAATCAGAGGGAGAATGG - Intergenic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1163488744 19:17605144-17605166 AGGGGGAATTAGCAGCAATAGGG + Exonic
1163779756 19:19240072-19240094 AGGGAGGATGAGGAGCAGGAGGG - Intronic
1164120443 19:22261145-22261167 TGGGAGAACTCGAAGCAGGGCGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1165361669 19:35340802-35340824 CGGGAGAAGAGGAAGCAGGAGGG + Intronic
1165373748 19:35426864-35426886 AGGGAAAGCAAGAAGCAGGATGG - Intergenic
1165715868 19:38045607-38045629 AGAGAGAATAACAGGCAGGAAGG + Intronic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1166536510 19:43578110-43578132 AGGGAGAGTGAGGACCAGGAGGG - Intronic
1166979549 19:46624429-46624451 AGAGAGAAAGAGAAACAGGAAGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167604299 19:50473288-50473310 AGGGAGAAATAGAGGAAGGAGGG - Intronic
1167634243 19:50644785-50644807 ATGGAGAATTAGATAAAGGATGG + Intronic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1168103079 19:54151397-54151419 AGTGGGGTTTAGAAGCAGGACGG + Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168572177 19:57480438-57480460 TGGGAGAATCAGAAGCATGTTGG + Intergenic
925443333 2:3907122-3907144 AGGGAGGAATGGAAGCAGAAGGG - Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925644177 2:6019309-6019331 CGGGAGAATTAGGTGCAGGCAGG + Intergenic
925666931 2:6267703-6267725 ATGGAGAATTAAAAGTAGAATGG + Intergenic
925684079 2:6453285-6453307 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
925993798 2:9275438-9275460 TGGGAGTATCAGAGGCAGGAGGG + Intronic
926064942 2:9831090-9831112 AGGGTGGATGAGAAGCAGCAAGG + Intergenic
926365790 2:12132155-12132177 AGGGAGAAATGGAAGGAGGGAGG + Intergenic
926517154 2:13861898-13861920 AAGGATAATTAGAGGCAAGAGGG + Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927599479 2:24428116-24428138 TGGAAAAATTAAAAGCAGGATGG - Intergenic
927918287 2:26950596-26950618 AGGAAGAATTAGATGCAAAAGGG + Intergenic
928877332 2:36055555-36055577 AAGGAGAATGAGATGCAGAAAGG + Intergenic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929569924 2:43016113-43016135 GGAGAGAAGTAAAAGCAGGAGGG - Intergenic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
930669223 2:54130551-54130573 GGGCAGAATTGGAAGCAGGGAGG + Intronic
930982819 2:57548050-57548072 AGGAAGAAATGAAAGCAGGAAGG + Intergenic
931152010 2:59585017-59585039 AGGGGGAGTAAGAAGAAGGAGGG + Intergenic
931266192 2:60662316-60662338 AGAGAGCAGTGGAAGCAGGAAGG - Intergenic
931431448 2:62212059-62212081 AGGGTGAATTTGGAGCAGGAAGG - Intronic
931442889 2:62303923-62303945 AGGTAGAGTTAGATGTAGGAAGG - Intergenic
932486061 2:72085101-72085123 ATGTAGAATGAGAAGCAGGGTGG + Intergenic
932508855 2:72264783-72264805 AGAGAGAATGAGAGGCAGTAGGG - Intronic
932993136 2:76812797-76812819 AGGAAGAATAAGGAGGAGGAGGG - Intronic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933063744 2:77769224-77769246 AGGGAGAATTAGATGTGGAATGG - Intergenic
933427877 2:82136055-82136077 AGGGAGAAGTAGGAGAAGGGAGG - Intergenic
934121906 2:88848314-88848336 GGAGAGAATTAGAAGAGGGAAGG - Intergenic
934732173 2:96666265-96666287 GAGGAGAATTATTAGCAGGATGG + Intergenic
934735311 2:96687083-96687105 AGGGAGGATTAGAAGCAGGGAGG - Intergenic
934924411 2:98371944-98371966 AGGAAGATTTTGAAGCAGAATGG + Intronic
935118548 2:100159412-100159434 AGGGAGAAATTGGATCAGGAGGG + Intergenic
936342165 2:111643304-111643326 AGAGAAAATTAGAAGGAGGAAGG - Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937029902 2:118730338-118730360 ATGGAGATTTAGAAACAGCATGG - Intergenic
937267857 2:120628373-120628395 GGGGAGAATTGGAGGGAGGAAGG + Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937552319 2:123108925-123108947 AGGGAGAGGGAGGAGCAGGATGG - Intergenic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
937650133 2:124310495-124310517 AGGGGGCATTAGAGGAAGGAAGG - Intronic
937689725 2:124741814-124741836 AGAGAGAATAAGGAGGAGGAGGG - Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938572525 2:132573263-132573285 AGGGAAAAATAGAGGAAGGAGGG - Intronic
938622061 2:133066527-133066549 AGGAAAAAATAGAAGAAGGAAGG - Intronic
939101598 2:137900548-137900570 AGGGAGAATAGGAAGCCAGAGGG - Intergenic
939873092 2:147546976-147546998 ACTGACATTTAGAAGCAGGAAGG + Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
942325418 2:174772323-174772345 AGGGAGATTGTGAAGCAGGACGG - Intergenic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942603267 2:177663319-177663341 AGGCAGATTTTGAAGCTGGAAGG + Intronic
942651857 2:178177402-178177424 AGATAGAATTAGATGCAGGTAGG + Intergenic
942845487 2:180419559-180419581 AGGGACTATTAGAAGAAAGAAGG + Intergenic
942847116 2:180440410-180440432 AGGCAAAATTAGAACCAGGGAGG - Intergenic
942950660 2:181717445-181717467 GGGGAGAATTAGAAAGAAGAGGG - Intergenic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943575936 2:189631096-189631118 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
943852454 2:192741850-192741872 AGGGTGATTTAGAGACAGGAGGG - Intergenic
944534878 2:200698880-200698902 TGGGAGAATGAGAAGGATGAAGG + Intergenic
944941482 2:204632802-204632824 ACGGAGAATGAAAAGCAGGGTGG - Intronic
945111388 2:206363509-206363531 TGGGACAATTAGAAGCAGTGGGG - Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945466449 2:210175173-210175195 AGAGGGAAATAGAAGCAGAACGG + Intergenic
945840842 2:214886276-214886298 AGGGAGAATCAAAAACAGCACGG + Intergenic
946017120 2:216612894-216612916 AGGGAGAGTTTGATGCAGGGAGG + Intergenic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947447687 2:230176981-230177003 AGGGAGAAATGGAAGGAGAAAGG - Intronic
947589623 2:231378177-231378199 AGGGAGAGTTAGAGGAAGCAAGG + Intergenic
947986787 2:234454958-234454980 AGGAACAACTAGAAGCACGAGGG + Intergenic
948221238 2:236271396-236271418 AGGGACAACTTGAAGCAGGGAGG - Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169547514 20:6665695-6665717 AGGGAGGAAGAGAGGCAGGAAGG - Intergenic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1170264332 20:14447878-14447900 AGGGGGAATTAGCTGCTGGAGGG + Intronic
1170277949 20:14613890-14613912 AGGGAGACTTAGAATAACGATGG - Intronic
1170606987 20:17882147-17882169 AGCAAGAATTAGAGTCAGGAGGG + Intergenic
1170815186 20:19708074-19708096 AGGGAGAATCAGAAGAAAGGGGG + Intronic
1170933822 20:20792855-20792877 AGAGAGAGAGAGAAGCAGGAAGG - Intergenic
1171177672 20:23065629-23065651 AGAAATGATTAGAAGCAGGAAGG + Intergenic
1171536781 20:25899237-25899259 AGGGAAGACTAGAGGCAGGAAGG + Intergenic
1171839723 20:30194502-30194524 AGGGAAGACTAGAGGCAGGAAGG + Intergenic
1172782677 20:37446566-37446588 AGGAAGATTCAGCAGCAGGAAGG - Intergenic
1173009853 20:39172080-39172102 AGGGAGGATAAGATGCAGCAGGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173906008 20:46629739-46629761 AGAGAGATTAAGAAGCAGAAGGG - Intronic
1174333169 20:49837177-49837199 TGGGACAACTAGAAGCAGGGAGG - Intronic
1174501340 20:50987259-50987281 AGGAAGAATGAGAAACAGGCAGG + Intergenic
1174707047 20:52667671-52667693 AGGGGGAATGAGAAGGTGGAGGG - Intergenic
1175493191 20:59393130-59393152 AAGGAGAGTTAGAGGCAGAACGG - Intergenic
1175839549 20:62018504-62018526 AGAGAGGAGTAGAGGCAGGAGGG - Intronic
1176582283 21:8543052-8543074 AGGGAAGACTAGAGGCAGGAAGG - Intergenic
1177118874 21:17118050-17118072 AGGGAGAAGATGATGCAGGAAGG - Intergenic
1177490665 21:21821944-21821966 TGGCAGCATTTGAAGCAGGAAGG + Intergenic
1177911934 21:27043626-27043648 AGGGAGACATAGAAGCAGGTGGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1180265118 22:10520100-10520122 AGGGAAGACTAGAGGCAGGAAGG - Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1182043025 22:27253217-27253239 GGAGAGAATTAGAGCCAGGACGG + Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182383890 22:29919040-29919062 AGGGAGAATAAGAAATAGGCTGG - Intronic
1182615480 22:31586169-31586191 AGGTACAAAGAGAAGCAGGAGGG - Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183091100 22:35522770-35522792 AGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632051 22:39039564-39039586 ACAGACATTTAGAAGCAGGAGGG - Intergenic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637932 22:39076392-39076414 ACAGACATTTAGAAGCAGGAGGG - Intronic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183945698 22:41324619-41324641 AGGGAGCATTAGCCACAGGAGGG + Intronic
1184002112 22:41682590-41682612 AGGAAGAATTAGGTGAAGGATGG + Intronic
1184430937 22:44441304-44441326 AGGGAGAGTCAGATGCAGGTTGG - Intergenic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184821132 22:46909922-46909944 AGGGAGATGAAGAAGCAGGGCGG - Intronic
1184959117 22:47916076-47916098 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
949604389 3:5637277-5637299 TGGGAGAATTAGAAGGAGGGAGG + Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950265626 3:11570795-11570817 GGGGACATTTAGAAGCAGGGAGG - Intronic
951113520 3:18833333-18833355 AGGCTAAATTAGAAGCAAGATGG + Intergenic
951930681 3:27963606-27963628 AGAGAGAATTAGGACCAAGAAGG + Intergenic
953042415 3:39267182-39267204 AGGGAGAACCATGAGCAGGAGGG + Intronic
953137303 3:40192253-40192275 AGGGAGAATTAGAAAGGTGAGGG - Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953285474 3:41602383-41602405 AAGGAGAATTGGAAGGGGGAAGG + Intronic
953462493 3:43093106-43093128 AGGCAGAATTGGCAGCAGGTGGG + Intronic
953683467 3:45057851-45057873 GGGGACAACTGGAAGCAGGAAGG + Intergenic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955611285 3:60759954-60759976 AGGGAGAAAGGCAAGCAGGAAGG - Intronic
955927993 3:64026545-64026567 AGGAAGTGGTAGAAGCAGGAAGG - Intergenic
956530411 3:70211747-70211769 AGGGAGAAAGAAAAGCAGAAAGG - Intergenic
956530431 3:70211847-70211869 AGGGAGAAAGAAAAGCAGAAAGG - Intergenic
956864654 3:73357086-73357108 AGGGAGGGTCAGAAGAAGGAAGG - Intergenic
957273012 3:78055616-78055638 GGGGAAAACTAGAAGCAGGGAGG + Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
957892046 3:86372468-86372490 AAGGAGAATTAAAAATAGGAGGG + Intergenic
957947155 3:87079674-87079696 TGGGAGAATAAGTAGCAGAAAGG - Intergenic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959296816 3:104545819-104545841 CAGGACAATTAGAAGCAGGGTGG - Intergenic
959345972 3:105194786-105194808 AGAGTGAATTATAAGCAGCATGG - Intergenic
959939075 3:112061175-112061197 AGTGAGAATTATTAACAGGAGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960192120 3:114719194-114719216 GGGGGGAAATAGAAGCAAGAAGG + Intronic
960320982 3:116235462-116235484 AGGGAGAAATGGAAGGAGAAAGG + Intronic
960927817 3:122813501-122813523 AGAGAGGATTATGAGCAGGAAGG - Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962930864 3:140034659-140034681 TGGGAGAGTGAGAAGCAGGGAGG + Intronic
963274218 3:143314313-143314335 AGGGAGGATTGTGAGCAGGAAGG - Intronic
963844846 3:150144805-150144827 AAGGAAAACTTGAAGCAGGAAGG + Intergenic
964397266 3:156258533-156258555 AAGGAGAATTGGCAGCAGGCAGG - Intronic
964397737 3:156265329-156265351 AGGGAGAAGAAGTAGCTGGATGG - Intronic
964540805 3:157777533-157777555 TTAGAGAATTAAAAGCAGGATGG - Intergenic
964690219 3:159441961-159441983 AGCTGGAATTATAAGCAGGAGGG + Intronic
965347735 3:167572963-167572985 AGGAAGAATTAGAAAGGGGAGGG - Intronic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965786243 3:172338347-172338369 AGAGAGTATCAGAGGCAGGAAGG + Intronic
966347044 3:178991402-178991424 AGTGAGAATATGAAGTAGGAAGG - Intergenic
966409211 3:179631362-179631384 AGAGCTAATTAGAAGCAGAATGG - Intergenic
966575258 3:181493785-181493807 AGGGAGTATTGACAGCAGGATGG + Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967859865 3:194142256-194142278 AGGAAGGGTTAGAAGCAGAAGGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969481298 4:7448470-7448492 AGGGAGACATGGAAGAAGGAAGG - Intronic
969974536 4:11084758-11084780 AGGGAAAGCTAGAAGCTGGATGG + Intergenic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970092090 4:12421249-12421271 AGGGACAAGTTGAAGCAGGGAGG - Intergenic
970122162 4:12768182-12768204 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
970652496 4:18193941-18193963 TTGGAGAAATATAAGCAGGATGG + Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971417197 4:26442644-26442666 AGGAAGACTGAGAAGTAGGAAGG - Intergenic
971500264 4:27311453-27311475 AGGGAGATCTAGAAGGAGGGAGG + Intergenic
971734249 4:30425661-30425683 AGGGAGAAAGAGATGCAGGGAGG + Intergenic
972689464 4:41382483-41382505 AGGGGGAATTGGAAGCAGGAGGG + Intronic
973291167 4:48472198-48472220 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973842653 4:54877913-54877935 AGAGAAGATTAGAAGCAAGAGGG + Intergenic
974475895 4:62379300-62379322 AGGGAGAATTAGGACAAGTATGG + Intergenic
974845802 4:67350275-67350297 AGGGAGAATTCAAAAAAGGAAGG + Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975405116 4:73980357-73980379 AGGTAGAGTTAGAGGCAGAAAGG + Intergenic
975504421 4:75122660-75122682 AGAAAGAATAAGAAGAAGGAGGG + Intergenic
975504436 4:75122774-75122796 AGAAAGAATAAGAAGAAGGAGGG + Intergenic
976335016 4:83875578-83875600 ATGCAGAATTAGATACAGGATGG - Intergenic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977528921 4:98176743-98176765 AGGCAGAATTAGAAGAAGACAGG + Intergenic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
978542033 4:109827531-109827553 AGTGAGATTTGGAAGTAGGAAGG + Intergenic
978604053 4:110459873-110459895 ATGGAGAGTTTTAAGCAGGAGGG + Intronic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
980133849 4:128841868-128841890 AGGGAGTATTTCAGGCAGGATGG + Intronic
980259560 4:130430881-130430903 AGGGAGAAGTTGAAGCATCATGG + Intergenic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
982445760 4:155489161-155489183 AGGGAAAATGAGAACAAGGAAGG - Intergenic
982473304 4:155820313-155820335 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
983432444 4:167668781-167668803 AGGAAGGATCAGAGGCAGGATGG + Intergenic
983575439 4:169256320-169256342 AGGGAGAAATAGAGGGAGGGAGG + Intronic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
986211761 5:5680048-5680070 AGGCAGCATCAGAAGCATGAAGG - Intergenic
986271272 5:6233004-6233026 AGGGAGAAATAGCTGGAGGAGGG + Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987712105 5:21513652-21513674 AGTAAGAATAAGAAACAGGATGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988179950 5:27777691-27777713 AGAAAGAATGAGAAGAAGGAAGG + Intergenic
988302304 5:29447136-29447158 AGTAAGAATAAGAAACAGGATGG + Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988980957 5:36568733-36568755 TGGGTGAAGTAGAAGCAGAATGG + Intergenic
989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG + Intronic
989981922 5:50655684-50655706 AGAGAGAAAAAGAAGAAGGAAGG - Intergenic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990247517 5:53878012-53878034 AGAGAGAAATAGAAGTAGGTGGG - Intergenic
990352843 5:54936087-54936109 AGGGAGAATGAGACTCAGGAAGG - Intergenic
990677636 5:58205632-58205654 TGGGAGATTTGGAAGGAGGAAGG - Intergenic
991283590 5:64943777-64943799 AGGAAAAATTAGAAGCAAAAGGG + Intronic
991569181 5:68036429-68036451 AGGGAAAATGAAAAGCAAGATGG + Intergenic
991762468 5:69932788-69932810 AGTAAGAATAAGAAACAGGATGG - Intergenic
991784857 5:70185318-70185340 AGTAAGAATAAGAAACAGGATGG + Intergenic
991841696 5:70807838-70807860 AGTAAGAATAAGAAACAGGATGG - Intergenic
991877304 5:71185711-71185733 AGTAAGAATAAGAAACAGGATGG + Intergenic
992264986 5:75009611-75009633 AGAGACCATTAGAAGTAGGAGGG + Intergenic
993723140 5:91341458-91341480 AGGCAGAAGTAGAAACAGGGAGG + Intergenic
993859360 5:93115941-93115963 AGAGAGAATGGAAAGCAGGAGGG + Intergenic
994278781 5:97874401-97874423 AGGGAGAGTGAGAAGGAGAAAGG + Intergenic
995236805 5:109838256-109838278 GGAGAGAATTAGCAGCAAGAGGG + Intronic
995846577 5:116500301-116500323 AGGCAGGATTTGAACCAGGATGG - Intronic
995981300 5:118107515-118107537 AGAGAGAATGAGAACCAGCAGGG - Intergenic
996256909 5:121415561-121415583 GGGGAAAATTAGATGGAGGAGGG - Intergenic
996915321 5:128705017-128705039 AGGGAGAAATACAGGAAGGAAGG - Intronic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997639780 5:135441690-135441712 CGGGAGTATTAGAAGCAGGCAGG - Intergenic
998910995 5:146960142-146960164 AGGGAGAATTATAGTCAGGTAGG - Intronic
999545681 5:152626018-152626040 TGGGACAACTCGAAGCAGGAAGG - Intergenic
999764288 5:154726858-154726880 AGAGAGAATGAGAACCAGCAGGG + Intronic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000422294 5:161052617-161052639 AGGAAGTAGTAGAATCAGGATGG - Intergenic
1001108411 5:168875326-168875348 AGGGAGAAATGAAAGGAGGAAGG + Intronic
1001701886 5:173712668-173712690 AGGGCGAGTTGGAAGCAGGGAGG + Intergenic
1003292699 6:4793628-4793650 AGGGAGACTTAGAAGGAAGCCGG + Intronic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004658937 6:17692536-17692558 AGGGAGGATGGGAAGAAGGAAGG + Intronic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006663799 6:35674020-35674042 AGGGAGAAAGGGAAGAAGGAAGG - Intronic
1006911264 6:37565162-37565184 AGAGAGAATTCCAAGCAGAAGGG - Intergenic
1007181357 6:39931650-39931672 AGGGAGAATGAGGGGGAGGAGGG - Intronic
1007595011 6:43045915-43045937 AGGGCCAGATAGAAGCAGGAGGG + Intronic
1007817559 6:44535225-44535247 AGGAAGGATTAGCAGGAGGATGG + Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008485946 6:52035898-52035920 AGGGAGAAGTAGTGACAGGAGGG + Intronic
1009005601 6:57783042-57783064 AGTAAGAATAAGAAACAGGATGG + Intergenic
1009627057 6:66147310-66147332 AGGAAGAGTTAGAAGCAAAATGG - Intergenic
1009640934 6:66335184-66335206 AAGGAGAATTAGAAGAAGAGAGG - Intergenic
1009925931 6:70120712-70120734 ATGGATACTTAGAAGCAGGCTGG - Intronic
1010180815 6:73084908-73084930 TGGGAGAATAAGAACCAAGAGGG + Intronic
1011113783 6:83867335-83867357 TTGGAGAATTATAAGAAGGAAGG + Intronic
1011360343 6:86517375-86517397 AGGGAGAAATATAACCTGGAAGG - Intergenic
1012043167 6:94236561-94236583 AGGGGGGATTGGGAGCAGGAGGG + Intergenic
1013075331 6:106765861-106765883 AGGGAATACTAGAAGCAAGAAGG + Intergenic
1013627359 6:111951158-111951180 AGGGAGAATGAGCAGAGGGAAGG + Intergenic
1014391045 6:120864845-120864867 TGGGAAAAGTAGTAGCAGGATGG + Intergenic
1014543757 6:122708196-122708218 AAGAGGAATTAGAAGCTGGAGGG + Intronic
1014968433 6:127784440-127784462 AGGCAGACTGAGAAGCAAGAGGG - Intronic
1015115049 6:129638607-129638629 AGGGAGAATTGGAAGAAGAGTGG - Exonic
1015167533 6:130214770-130214792 AGAGAGAATTAGAATGAGAAGGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015996487 6:138999903-138999925 ATGTAGAATGAGAAGCAGAAAGG + Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016565431 6:145447174-145447196 AGGAAGAAATAAAAGAAGGAAGG + Intergenic
1016696354 6:147000653-147000675 AAAGAGAAATGGAAGCAGGAAGG + Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018561971 6:165109579-165109601 AGAAAGAATTAGAAGCTGGGCGG - Intergenic
1018779161 6:167046377-167046399 AGGGAAAAATGGAAGGAGGAAGG + Exonic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019705046 7:2493588-2493610 AGGGAGAGCTAGAGACAGGAGGG - Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020650234 7:10866022-10866044 GGAGAGTACTAGAAGCAGGAGGG - Intergenic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022970708 7:35514238-35514260 AGGGAGACCTGGAAGCAGAAGGG - Intergenic
1024967868 7:55040362-55040384 AGGGATAATTAATAGGAGGAAGG + Intronic
1025288249 7:57685944-57685966 AGGGAAGACTAGAGGCAGGAAGG + Intergenic
1026143838 7:67728598-67728620 AGGGAAAAAGACAAGCAGGAAGG + Intergenic
1026319269 7:69254802-69254824 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
1026900263 7:74033199-74033221 AGGCAGAATTAGAAGCCAGAGGG + Intronic
1026904071 7:74052730-74052752 AGGGAGAGAGAGAGGCAGGAAGG + Intronic
1027351164 7:77313031-77313053 AGGAAGAATGAGAAACATGAGGG - Intronic
1027487323 7:78778351-78778373 GGTGAGAATCAAAAGCAGGAAGG - Intronic
1027516431 7:79147778-79147800 AGGGAGAATGCAAAGCATGAGGG + Intronic
1027635366 7:80665916-80665938 TGGGAGAATTAAAGGGAGGAAGG + Intronic
1027833201 7:83206906-83206928 AGGGAGAGTGAGAAGGAGCAAGG - Intergenic
1028133218 7:87201250-87201272 AGAGAGCATTAGAAGTAGGAGGG - Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028820151 7:95200076-95200098 ATGGAACATTAGAAGCTGGAAGG - Intronic
1028974265 7:96894027-96894049 TGGGAGACCTAGAGGCAGGATGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031077630 7:117228098-117228120 AGGAAGAAATAGGAGCAGGGTGG - Intronic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031877695 7:127160738-127160760 AGGGAGGATCAGAAGCAAGTGGG + Intronic
1032300910 7:130685996-130686018 AGGAAGAAATAAAAGCAGGTAGG + Intronic
1033458869 7:141527456-141527478 AGGGAGAACTCAAAGCAAGAAGG - Intergenic
1033539256 7:142340831-142340853 AGAGAGAATGAGAAGAAGAAAGG - Intergenic
1034109190 7:148520022-148520044 AGGGACAACTCGAAGCAGGGAGG - Intergenic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035862057 8:3039481-3039503 AGGAAGAATTGAAAGAAGGAAGG - Intronic
1036098848 8:5755525-5755547 AGGCAGAGTTAGAAGGAGGCAGG + Intergenic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036497628 8:9283839-9283861 AGGGAGAGGAAGAAGCTGGAAGG - Intergenic
1036767302 8:11557003-11557025 AGGGAGGGTGAGAAACAGGAGGG + Intronic
1037644051 8:20774098-20774120 AGGGAGATTTAGGAGCAGACAGG - Intergenic
1037917215 8:22779903-22779925 AGGGAAAGTTAAAAGCAGCATGG + Intronic
1037928402 8:22863192-22863214 ATGGAGAATGAGATGCAGAAAGG + Intronic
1038070345 8:24006294-24006316 AGGGAGAGTGGGAAACAGGAAGG - Intergenic
1038409227 8:27345223-27345245 AGGGAGAAATAAAAGCAAGGAGG - Intronic
1039110768 8:34038901-34038923 GGGGAGAACTTGAAGCAGGGAGG - Intergenic
1039118668 8:34121355-34121377 AGAGAGAATGAGAAGCAAAATGG + Intergenic
1039412691 8:37368535-37368557 AGGAAGAATGAGAGGGAGGAAGG + Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1039816616 8:41100317-41100339 AGTGATAATTAGAAGGAAGAAGG - Intergenic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043373847 8:79625586-79625608 AGGGAGAATTATAAGAAATAAGG + Intronic
1043557478 8:81448841-81448863 AGGTAGAATTACTAGCAAGAAGG + Intergenic
1044358309 8:91252061-91252083 AAGGAAAATTAGAAGAAAGAGGG + Intronic
1044386508 8:91595246-91595268 AGGGAGAAACAAAAGCAGCAGGG + Intergenic
1045554932 8:103206774-103206796 AGGGAGGGAGAGAAGCAGGATGG + Intronic
1046096506 8:109568728-109568750 AGGGACAGTTTGTAGCAGGAAGG - Intergenic
1046476367 8:114749892-114749914 AGGGAAAAGTGTAAGCAGGAGGG - Intergenic
1046485905 8:114888313-114888335 AGGAAGAAATGGAAACAGGAAGG - Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1047261325 8:123263050-123263072 AGGGAGGCTTGGAAGAAGGAAGG + Intronic
1047369996 8:124248106-124248128 AGGGAGAAAGGGAAGCAGGCCGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048366402 8:133742529-133742551 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1049231753 8:141488360-141488382 AGGGAGGATGAGAGGAAGGAGGG - Intergenic
1049464667 8:142745358-142745380 AGGCAGAATTCGATGCTGGAAGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050785643 9:9398106-9398128 AGGGAGAAAGAGAAGCAGGGAGG - Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051433438 9:17004676-17004698 AAAGAGAATTAGTGGCAGGACGG - Intergenic
1051524190 9:18024418-18024440 AGGGAGTACTAGAGGAAGGAGGG - Intergenic
1051564322 9:18479819-18479841 AGGGAAAAGTACAAGTAGGAAGG + Intronic
1052027298 9:23587846-23587868 AGGAAGAAGTAAAAGAAGGAGGG + Intergenic
1052030318 9:23621182-23621204 AGAGACAATTAGAACCAGAAGGG + Intergenic
1052462211 9:28779891-28779913 AGGGATAGTAAGAAGCAGGGAGG - Intergenic
1053190732 9:36064763-36064785 AGGGAGAACAAGAAGAAGAATGG - Intronic
1053346219 9:37380170-37380192 AGGGAGAAAGAGAAGAAGGGAGG + Intergenic
1053469866 9:38338666-38338688 AGGGAGATTTAAACCCAGGATGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1054792043 9:69265536-69265558 AGGGAAAAGGACAAGCAGGAGGG + Intergenic
1056004379 9:82252235-82252257 TGGGAGAACTACAAGCAAGATGG + Intergenic
1056212158 9:84374819-84374841 ATCGAGAATTAGAAGAAGGCTGG + Intergenic
1056329203 9:85508036-85508058 AGGCAGAACTAGAAGCAGTGAGG - Intergenic
1056812059 9:89772553-89772575 AGAGAGACTTTGAAGGAGGAGGG - Intergenic
1056851355 9:90087176-90087198 AGGGAGAGATGGAAGGAGGAAGG + Intergenic
1057317637 9:93979920-93979942 AGGGAGAAATGCAGGCAGGAGGG - Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057497721 9:95574134-95574156 ACAGAGAAAGAGAAGCAGGAAGG - Intergenic
1057741658 9:97717417-97717439 AGGGGGACTTAGCTGCAGGAGGG - Intergenic
1057936613 9:99244930-99244952 AGGGAGACTGGGAAGAAGGAAGG + Intergenic
1059082188 9:111261843-111261865 AGAGAGAATTAAAAACAAGATGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059484945 9:114619662-114619684 AGTGAGAACAAGAAGCAAGAAGG - Intronic
1059524997 9:114983149-114983171 AGGGAGAATTGGAATCTGGAAGG + Intergenic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059613568 9:115924678-115924700 AGGGAGAAATGGAAGGAGGGAGG + Intergenic
1060309273 9:122444846-122444868 AGGGAGAAATTGGAGCATGATGG + Intergenic
1061534479 9:131239105-131239127 AGGGAGAGTTAGATGCGGAAGGG - Intergenic
1061865742 9:133491023-133491045 AGTGAGAAGGAGAAGCTGGAGGG + Intergenic
1062042732 9:134411553-134411575 AGGAAGGACTGGAAGCAGGAAGG - Intronic
1062066607 9:134531339-134531361 AGGGAGAATGAGATGCCAGAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203612301 Un_KI270749v1:21066-21088 AGGGAAGATTAGAGGCAGGAAGG - Intergenic
1185702977 X:2245272-2245294 AGGGACAACTGGAAGCAGGGAGG - Intronic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186058824 X:5681522-5681544 AGGAAGAAAGGGAAGCAGGAAGG + Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186280936 X:7992442-7992464 AGGGAGAAATAATGGCAGGAAGG - Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186892295 X:13971176-13971198 AGTCAGAAGTAGAAGCAGGGAGG - Intergenic
1187493679 X:19776317-19776339 GGGGAGAAATGAAAGCAGGAGGG + Intronic
1188142836 X:26573700-26573722 AAGGAGAATGAAAAGAAGGAAGG - Intergenic
1188630639 X:32355089-32355111 AGGAAGAAATGGAAGAAGGAAGG - Intronic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1190110446 X:47585897-47585919 AGGGAGAATTAGAGGGACCAGGG - Intronic
1192424230 X:71061160-71061182 AGAGAGAATTAGCAGAGGGATGG + Intronic
1194256221 X:91638236-91638258 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1194975593 X:100393433-100393455 AGAGAGAGAAAGAAGCAGGAGGG - Intronic
1196087857 X:111705885-111705907 AGGGAAAATCAGGAGAAGGAGGG - Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198421408 X:136473216-136473238 AGGGAGAGAGAGAGGCAGGAAGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199462327 X:148098445-148098467 AGGGAGAGTTAGCAGCTGGGAGG + Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic
1200395047 X:155980724-155980746 AGGGACAACTTGAAGCAGGGAGG - Intergenic
1200574950 Y:4877520-4877542 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1200770852 Y:7124047-7124069 AGGGAGAATGGGAAGGAGAATGG + Intergenic
1201063362 Y:10068085-10068107 AGGAAAAGTTAGAAGCAAGAGGG + Intergenic
1201592059 Y:15626378-15626400 ATGGAGCATTCAAAGCAGGAAGG - Intergenic