ID: 1099473424

View in Genome Browser
Species Human (GRCh38)
Location 12:83077963-83077985
Sequence TGCTAGTTAGGTATTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099473424_1099473433 26 Left 1099473424 12:83077963-83077985 CCCCCCACAATACCTAACTAGCA 0: 1
1: 0
2: 1
3: 11
4: 85
Right 1099473433 12:83078012-83078034 ATTTCTAAGGGACAACATCAAGG 0: 1
1: 0
2: 1
3: 23
4: 272
1099473424_1099473431 13 Left 1099473424 12:83077963-83077985 CCCCCCACAATACCTAACTAGCA 0: 1
1: 0
2: 1
3: 11
4: 85
Right 1099473431 12:83077999-83078021 CAGTGAATGGAAAATTTCTAAGG 0: 1
1: 1
2: 12
3: 48
4: 322
1099473424_1099473434 27 Left 1099473424 12:83077963-83077985 CCCCCCACAATACCTAACTAGCA 0: 1
1: 0
2: 1
3: 11
4: 85
Right 1099473434 12:83078013-83078035 TTTCTAAGGGACAACATCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 199
1099473424_1099473432 14 Left 1099473424 12:83077963-83077985 CCCCCCACAATACCTAACTAGCA 0: 1
1: 0
2: 1
3: 11
4: 85
Right 1099473432 12:83078000-83078022 AGTGAATGGAAAATTTCTAAGGG 0: 1
1: 1
2: 9
3: 46
4: 452
1099473424_1099473430 0 Left 1099473424 12:83077963-83077985 CCCCCCACAATACCTAACTAGCA 0: 1
1: 0
2: 1
3: 11
4: 85
Right 1099473430 12:83077986-83078008 CAGTGAGTGAGATCAGTGAATGG 0: 1
1: 0
2: 0
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099473424 Original CRISPR TGCTAGTTAGGTATTGTGGG GGG (reversed) Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
914881584 1:151551069-151551091 TGCTAATGAGCTATTTTGGGGGG - Intronic
915796511 1:158740270-158740292 TGCTAGTGTAGTTTTGTGGGAGG + Intergenic
915965432 1:160303511-160303533 TGATAGTTATGTATGGTGTGAGG - Intronic
916751207 1:167724242-167724264 TGGTAGTTCAGTATAGTGGGAGG + Intronic
918650167 1:186952718-186952740 TGCTTGTTAGGGGTTGGGGGAGG - Intronic
919888044 1:201949446-201949468 TTTTAGTTAGGTATGTTGGGTGG + Intergenic
923611610 1:235500694-235500716 TGCTAGTGTGGTGTTTTGGGAGG - Intronic
1068070374 10:52186486-52186508 TGGTAGTGAGGTCTGGTGGGAGG - Intronic
1074266490 10:111909610-111909632 CTCTAGTTAGGTTTTCTGGGGGG - Intergenic
1074400624 10:113138791-113138813 TGCTTGCTGGGTGTTGTGGGTGG - Intronic
1081028753 11:38050413-38050435 TACTAGCAAAGTATTGTGGGGGG + Intergenic
1081078183 11:38702565-38702587 TGCTTGCTACGCATTGTGGGTGG - Intergenic
1092984125 12:13828729-13828751 TTCTAGTTATTTATGGTGGGAGG + Intronic
1093607051 12:21104976-21104998 TGCTAGGCATGTATTGTGGGGGG + Intronic
1099473424 12:83077963-83077985 TGCTAGTTAGGTATTGTGGGGGG - Intronic
1099988810 12:89700791-89700813 TGTTGGTAAGGTATTGTGGAAGG - Intronic
1101671768 12:106882128-106882150 TGCTAGTTAGGGATTAAGTGGGG - Intronic
1103926043 12:124423763-124423785 TGCAAGTGAGGTATTGAGGGAGG - Intronic
1106350345 13:28923806-28923828 GGCTGGTTACTTATTGTGGGAGG + Intronic
1107566186 13:41607186-41607208 TGCCAGGCAGGTATTGTGGTAGG - Intronic
1111330612 13:86759422-86759444 AGGTAGTTAGGTATTGGTGGAGG + Intergenic
1112394523 13:99016758-99016780 TCCTAGTTACATATTGTGGCTGG - Intronic
1114240016 14:20858126-20858148 TGTAAGTCAGGTGTTGTGGGAGG - Intergenic
1116683008 14:47999654-47999676 TGCTATTTTGAGATTGTGGGAGG + Intergenic
1117258188 14:54001741-54001763 GGCTAGTTAGGGAGTGTGGGTGG - Intergenic
1117427223 14:55613299-55613321 TACTAGTTAGGTTTTTTGGGTGG + Intronic
1118162384 14:63302690-63302712 TTCTAGTTAGCTATTGGGGGTGG + Intergenic
1125219025 15:37311733-37311755 TGGTGGCAAGGTATTGTGGGGGG - Intergenic
1138802228 16:60047426-60047448 TGCTAGATAAGTGCTGTGGGTGG - Intergenic
1142624207 17:1181524-1181546 TGCTAGTCAGGGACGGTGGGAGG - Intronic
1150705070 17:67479089-67479111 TGCTGGTTAAATATTGGGGGTGG - Intronic
1152483211 17:80570275-80570297 TTCTAGTTGTGTATGGTGGGAGG + Intronic
1155301365 18:24432453-24432475 TTCTAATTAAGTATTTTGGGAGG - Intronic
1157335172 18:46732677-46732699 TGCTATTTAACTTTTGTGGGAGG + Intronic
1167226419 19:48244892-48244914 TTTTACTTAGGAATTGTGGGTGG - Intronic
1167227588 19:48258069-48258091 TTTTACTTAGGAATTGTGGGTGG + Intronic
932441667 2:71741182-71741204 TGCTAGTTAAGTATCTTAGGTGG + Intergenic
937668067 2:124509480-124509502 TGCCAGTTAGGCATTGTGCTAGG + Intronic
941223507 2:162815038-162815060 TGTTACTTAGTTATTGGGGGAGG - Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
944132899 2:196366004-196366026 TGGTAGGTAGTTATTGTGGGGGG - Intronic
945674521 2:212840165-212840187 TGGTAGTAAGGTATGGTGGGAGG + Intergenic
946788119 2:223269704-223269726 TGCTAGTAAGGTCTTGGGGTAGG + Intergenic
947081452 2:226401425-226401447 TGATAGTTGGGTATTATCGGAGG - Intergenic
947773769 2:232691463-232691485 TGCTAGATAGGTCTTGCGGCAGG + Intergenic
948918849 2:241052148-241052170 TGCGAGATAGGTAAGGTGGGTGG + Exonic
1170119696 20:12898510-12898532 TGCTTGTCAGGCCTTGTGGGGGG - Intergenic
1170762746 20:19265183-19265205 GGCTAGCCAGGTATTTTGGGGGG + Intronic
1176301977 21:5102784-5102806 GGGTAGTGAGGTAGTGTGGGAGG - Intergenic
1178243258 21:30926457-30926479 TGGTGGTTGGGTATTGTGCGTGG - Intergenic
1179855053 21:44159116-44159138 GGGTAGTGAGGTAGTGTGGGAGG + Intergenic
1181088513 22:20456496-20456518 TCCTAGGTGGGTGTTGTGGGAGG - Intronic
952531835 3:34270929-34270951 TGGTATTTAGGTATTTTGAGGGG + Intergenic
954846288 3:53560651-53560673 TACTAGTTATGTATTGTTCGTGG - Intronic
959452257 3:106518029-106518051 TGTTAGTGAGGTATTTTTGGTGG - Intergenic
960113225 3:113866083-113866105 TGCCAGTTAGGTGTAGTTGGTGG + Intronic
963478632 3:145839474-145839496 TCCTAGTTAGGGATGGTGGCTGG + Intergenic
966738854 3:183212932-183212954 TGTAATATAGGTATTGTGGGGGG + Intronic
970829216 4:20316134-20316156 TGCTTGCTAAGTCTTGTGGGAGG + Intronic
978239904 4:106502804-106502826 TCCTAGTGGGGTATTGAGGGAGG - Intergenic
978781305 4:112557867-112557889 GGCTAGAGAGGTATTGTTGGGGG - Intronic
978944123 4:114473433-114473455 TGCTGGTAAGGAATTGTGGGTGG + Intergenic
986849668 5:11796176-11796198 TGCTACTCAGCTAATGTGGGAGG - Intronic
987224718 5:15828216-15828238 TGCTATGTAGGTATTGTTGCTGG + Intronic
989710758 5:44394217-44394239 TGCTAGGTAGGCATTGTGAATGG + Intergenic
990751236 5:59019067-59019089 AGCCAGTTGGGTATTGGGGGAGG - Intronic
994821772 5:104661366-104661388 GGCTGGTTAGGTATTATGAGTGG + Intergenic
996836908 5:127803730-127803752 TCCTGGTCAGGTCTTGTGGGTGG - Intergenic
1002654754 5:180736630-180736652 TGCAAGTCAGGTCTTGTGGAAGG - Intergenic
1005566710 6:27103321-27103343 TGATATTTATGTATAGTGGGAGG + Intergenic
1013144957 6:107380263-107380285 TGGTAGGAAGGTATTGTGGAAGG + Intronic
1015143732 6:129963095-129963117 TTCTAGTTATTTAATGTGGGAGG + Intergenic
1021885694 7:25136478-25136500 TGCTAGTTAGGTCTTTTGTTGGG + Exonic
1022176405 7:27875517-27875539 GGCTAGCTAGGTCTGGTGGGTGG - Intronic
1022335486 7:29417816-29417838 TACTAGTAAGGTATTGTAGATGG + Intronic
1022517625 7:30986122-30986144 TGCAAGTTAGCTACTGTGGTTGG + Intronic
1028123565 7:87085342-87085364 TGCTAGTTAGGGAGGGAGGGAGG - Intergenic
1028354034 7:89884968-89884990 TGCTACTTAGATATTATGGCAGG + Intergenic
1028769782 7:94605015-94605037 TGGTGGTCAGGTGTTGTGGGAGG - Intronic
1031597916 7:123669261-123669283 TACTAGTTAGCTATAGGGGGCGG + Intergenic
1037217927 8:16480392-16480414 TGCAAGTTAGGTGTTTTGGGTGG - Intronic
1046816651 8:118591874-118591896 TGACAGTTGGGTATTTTGGGAGG + Intronic
1052032299 9:23642604-23642626 TCCTAGTTTGGTCTTGTGGGGGG - Intergenic
1057579936 9:96278795-96278817 TGCTGGCTGGGTTTTGTGGGAGG - Intronic
1185723534 X:2401257-2401279 TGTTAGTCAGGTATGGTGGCGGG - Intronic
1188303183 X:28530408-28530430 TCCTAGGTTAGTATTGTGGGAGG - Intergenic
1188318290 X:28703892-28703914 AGCTAGGTAGGAAATGTGGGAGG - Intronic
1189901711 X:45713202-45713224 AGGTAATTAGGTATTGGGGGGGG + Intergenic
1190148389 X:47919735-47919757 TGGTAGTTAGGTAATGTGGGTGG - Exonic
1190478715 X:50853179-50853201 TGGTAGTTGAGTGTTGTGGGGGG - Intergenic
1190959319 X:55229493-55229515 AGGTAATTAGGTATTGAGGGTGG + Intronic
1192267751 X:69551404-69551426 TGCAAGTTAGGGATGGTGGGAGG + Intergenic
1195724384 X:107899187-107899209 TGATAGTTAGGATTTTTGGGGGG - Intronic
1195991227 X:110684223-110684245 TCCTAGTTTGTTATTGTAGGAGG + Intronic
1196784852 X:119412692-119412714 TGCTATTTATGTGTTGTTGGTGG + Intronic
1202338653 Y:23836772-23836794 AGTTAGTTAGGTATTCAGGGTGG - Intergenic
1202532113 Y:25833300-25833322 AGTTAGTTAGGTATTCAGGGTGG + Intergenic