ID: 1099479741

View in Genome Browser
Species Human (GRCh38)
Location 12:83150893-83150915
Sequence ATCTATAAACAGTTGAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099479741_1099479742 -9 Left 1099479741 12:83150893-83150915 CCAGGATTCAACTGTTTATAGAT No data
Right 1099479742 12:83150907-83150929 TTTATAGATAAGCAGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099479741 Original CRISPR ATCTATAAACAGTTGAATCC TGG (reversed) Intergenic
No off target data available for this crispr