ID: 1099487693

View in Genome Browser
Species Human (GRCh38)
Location 12:83248739-83248761
Sequence CAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099487690_1099487693 3 Left 1099487690 12:83248713-83248735 CCGGAGACTTGTTAAATTGTTGT No data
Right 1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG No data
1099487689_1099487693 4 Left 1099487689 12:83248712-83248734 CCCGGAGACTTGTTAAATTGTTG No data
Right 1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099487693 Original CRISPR CAAAATGCTGATAGTGATAT GGG Intergenic