ID: 1099490406

View in Genome Browser
Species Human (GRCh38)
Location 12:83282113-83282135
Sequence CGTCACATGATAAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 2, 1: 56, 2: 102, 3: 80, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099490406 Original CRISPR CGTCACATGATAAAGGAGAA AGG Intergenic
900814835 1:4835642-4835664 AGTCACATGATAAAGGAGAAAGG + Intergenic
901903628 1:12389516-12389538 TGTCACATAATGAAGGAGAAAGG + Intronic
902637431 1:17743730-17743752 GGTGACAGGATCAAGGAGAAAGG + Intergenic
903088670 1:20889067-20889089 CGTCACCTGAAAAAAGAAAATGG - Intronic
905354366 1:37370969-37370991 CGTCACATTATAAAGGAAAAAGG - Intergenic
905465524 1:38150269-38150291 TGTCACTTGATAAAGGAAAAAGG - Intergenic
906096753 1:43229169-43229191 TGTCAAATGAGGAAGGAGAAAGG - Intronic
906879943 1:49578606-49578628 TGTCACATGATAAGGGAAAAAGG - Intronic
907781369 1:57569780-57569802 TGTCACATGATAAAGGAGAAAGG - Intronic
908540605 1:65118612-65118634 AGTCACTTGAGAAGGGAGAATGG - Intergenic
909577342 1:77189081-77189103 TGTCATATGATAAAGGAAAAAGG - Intronic
909811216 1:79933517-79933539 TGTCACATGATAAAGGAAAAAGG - Intergenic
910370935 1:86514309-86514331 TGTCACATGATAAAGGAGAAAGG - Intergenic
910562177 1:88602103-88602125 TGTCACATGATAAAGCAAAAAGG - Intergenic
910791525 1:91055984-91056006 TGTCACATGATAAAGGAAAAAGG + Intergenic
911270309 1:95793628-95793650 TGTTACATGATAAAGGTAAAAGG - Intergenic
911791847 1:102027029-102027051 CTTCACATGACAAAGGAATATGG - Intergenic
911883846 1:103272521-103272543 CATCACATGAAAAAGGAGAAAGG - Intergenic
912050422 1:105522776-105522798 TATCAAATGATAAAGGAAAAAGG + Intergenic
912067283 1:105759092-105759114 TAACACATGATAAAGGAAAAAGG - Intergenic
912129637 1:106585901-106585923 TGTCACATGATAAAGGAGAAAGG + Intergenic
912733032 1:112126669-112126691 TGTCACATGATAAAGAAGAAAGG + Intergenic
913039162 1:115006233-115006255 TGTCACATGATAAAGGAAAAAGG + Intergenic
913559447 1:120002740-120002762 TGTCACATGATAAAGGAGAAAGG - Intronic
913638413 1:120787800-120787822 TGTCACATGATAAAGGAGAAAGG + Intergenic
914280037 1:146162162-146162184 TGTCACATGATAAAGGAGAAAGG - Intronic
914625560 1:149458145-149458167 TGTCACATGATAAAGGAGAAAGG + Intergenic
915667389 1:157457509-157457531 TGTCACATGATAAAAAGGAAAGG + Intergenic
915709939 1:157885819-157885841 TCTCACATGATAAAGGAAAAAGG - Intronic
916784334 1:168073613-168073635 TGTCACATTATAAAGAAGATGGG - Intronic
917634706 1:176923893-176923915 AATCACAAGATAAAGGATAAGGG - Intronic
918768742 1:188524033-188524055 TGTCCCACGATAAAGGAGAAAGG - Intergenic
918958519 1:191240099-191240121 TGTTACATGATAAAGGAAAAAGG - Intergenic
919242088 1:194926672-194926694 TGTCACATGATAAAGGAAAAGGG - Intergenic
919428140 1:197459511-197459533 CCTCACATGACAAAGGAACAAGG + Intronic
921297793 1:213721240-213721262 CATCACATGCTGAAGAAGAAGGG - Intergenic
924846844 1:247782984-247783006 TGTCACATGATAAAGAAAAAAGG + Intergenic
1065178728 10:23104217-23104239 CGTCACAAGAGAAAAGGGAACGG + Exonic
1066169825 10:32829478-32829500 CATCACATGATAAAGGAAAAAGG - Intronic
1068123402 10:52807945-52807967 ACTCACATGATAAGTGAGAAAGG - Intergenic
1068250993 10:54440068-54440090 CTTCACATGATTTAAGAGAATGG + Intronic
1068447474 10:57140752-57140774 TGTCACATGACAAAGGAAAAAGG - Intergenic
1069192023 10:65504211-65504233 AATCACATGATAATGGAAAAAGG + Intergenic
1069304567 10:66952686-66952708 AGTCAGATTATAAAGGAAAATGG - Intronic
1069790540 10:71017433-71017455 TGTCACATGATAAAGGAGAAAGG + Intergenic
1071827891 10:89343388-89343410 CTTCAAATGAGAAGGGAGAAGGG + Intronic
1071937964 10:90551416-90551438 TGTCACATGATACAGGAGAAAGG - Intergenic
1072184586 10:93024210-93024232 GGTCAAATGATAAAGCAGTAAGG + Intronic
1072226479 10:93374717-93374739 CGTCACCTGATATGGAAGAAGGG - Intronic
1073855000 10:107663530-107663552 GGTCACATGATAAAGGAAAAAGG - Intergenic
1074133201 10:110602565-110602587 AGTCTCAAGATGAAGGAGAAGGG + Exonic
1074243920 10:111668823-111668845 TGTCACATGATAAAGGAGAAAGG + Intergenic
1075607090 10:123819570-123819592 TGTCATATCATAAAGGAAAAAGG - Intronic
1077803627 11:5567711-5567733 TGTTACATGATAAAGGCAAAGGG - Intronic
1079106764 11:17576948-17576970 CTCCACATGGTAAAGGAGAGTGG + Intronic
1079675004 11:23215981-23216003 AGGGACAAGATAAAGGAGAAAGG + Intergenic
1080041979 11:27768663-27768685 TGCCACATGATAATGGAAAAAGG + Intergenic
1080076884 11:28159663-28159685 TGTCACATGATAAAGGAGAAAGG - Intronic
1081110812 11:39130893-39130915 TGTCACATGATAAAGGAAAAAGG - Intergenic
1083735806 11:64680039-64680061 CAACACATGATGAATGAGAAGGG + Intronic
1085686248 11:78624324-78624346 TGTCATATGATAAAGGAGAAAGG - Intergenic
1085748608 11:79137697-79137719 TGTCACATGATAAAGGAGAAAGG - Intronic
1085937853 11:81171556-81171578 TGTCACATGATGAAGGAAAAAGG + Intergenic
1086141346 11:83504051-83504073 TGTCACATGATAAAGGAAAAAGG + Intronic
1086278888 11:85162594-85162616 TGTCACATAATAAAGGAAAAAGG - Intronic
1086834394 11:91602526-91602548 TGTCACATGATAAAGGAAAAAGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088407324 11:109496523-109496545 TGTCACATGATAAAGGAGAAAGG + Intergenic
1091052029 11:132380871-132380893 TGTCACATGATAAAGGAGAAAGG - Intergenic
1091698289 12:2642672-2642694 GGTCACAAGATAGAGAAGAAAGG - Intronic
1092093913 12:5826082-5826104 TGTCACTTGATAAAGGAAAAAGG - Intronic
1092797939 12:12132058-12132080 CTTCAAATGAACAAGGAGAAGGG + Intronic
1093036629 12:14337813-14337835 GATCACATGATAAAAAAGAAAGG - Intergenic
1093645993 12:21585783-21585805 TGTCACATGATAAAGGAAAAAGG - Intronic
1093981294 12:25478424-25478446 TCTTACATGATAAAAGAGAAAGG + Intronic
1095665759 12:44795837-44795859 CCTCACATGTTAAGGGAGATGGG + Intronic
1095844116 12:46727830-46727852 TGTCACATGATAAAGGAAACAGG + Intergenic
1095855972 12:46861547-46861569 TGGCACATGATAAAAGAGAAAGG + Intergenic
1097238603 12:57557229-57557251 TGTCACATAATAAAGGAAAAAGG + Intronic
1097437550 12:59570125-59570147 TGTCACATGATAAAGGAGAAAGG + Intergenic
1097518545 12:60638163-60638185 TGTCACATGATAAAGGAAAAAGG - Intergenic
1097564376 12:61250300-61250322 TGTCACATAATAAAGGAAAAAGG + Intergenic
1097619252 12:61920530-61920552 AGTGACATGACAAAGGAAAAGGG - Intronic
1097821061 12:64129767-64129789 TGTCACATGCTAAAGGAAAAAGG + Intronic
1097843061 12:64340615-64340637 TGTCACATGCTAAAGGAAAAAGG + Intronic
1097972321 12:65647529-65647551 CGGCAGAAGATAAAGGAAAATGG + Intergenic
1098418096 12:70259785-70259807 AGTCTCATGATAAAGGAAAGCGG - Intronic
1098731377 12:74039842-74039864 TGTCACATGATAAAGGAAAACGG - Intergenic
1098736336 12:74110630-74110652 TGTCACATGATGAAGGAAAAAGG + Intergenic
1099183098 12:79490277-79490299 TGTCACATGATAATGAAGAAAGG + Intergenic
1099366199 12:81767518-81767540 TGTCACATGATGAAGAAAAAAGG - Intergenic
1099379115 12:81934409-81934431 TGTCACATGATAAAGGAAAAAGG + Intergenic
1099490406 12:83282113-83282135 CGTCACATGATAAAGGAGAAAGG + Intergenic
1099578325 12:84407521-84407543 TGTCACATGATAAAGGATAAGGG - Intergenic
1099700608 12:86077403-86077425 CATTACATGATAAAAAAGAAAGG + Intronic
1101543339 12:105684735-105684757 TGTCCCATGATAAAGGAGAAAGG - Intergenic
1107312151 13:39090733-39090755 CCTCACAAAAGAAAGGAGAAAGG + Intergenic
1107983302 13:45753828-45753850 GGTCACAGGATAAAGGAGAAAGG + Intergenic
1108035502 13:46286228-46286250 TGTTACAAGAGAAAGGAGAATGG - Intergenic
1108207647 13:48106903-48106925 AGCCACATGATCAAGGACAACGG + Intergenic
1108904550 13:55452097-55452119 TGAAACATGATAAAGGAAAAAGG - Intergenic
1108914035 13:55586774-55586796 TGTCACATGATAAAGGAAAAAGG + Intergenic
1109269764 13:60241730-60241752 AGTCACATCATAAAGGATACAGG + Intergenic
1109583360 13:64368648-64368670 TGTCATATGATAAAGGAAAAAGG - Intergenic
1109712412 13:66178726-66178748 TGTCACAAGATAAAGGGGAAAGG + Intergenic
1110377438 13:74808668-74808690 TGTCACATGATAAAGGAGAAAGG - Intergenic
1111198810 13:84907020-84907042 CGTCACATGATAAAGGAAAAGGG - Intergenic
1111246741 13:85550631-85550653 TGACAAATGATAAAAGAGAAGGG + Intergenic
1111317770 13:86583933-86583955 TATCACACGATAAAGGAAAAAGG - Intergenic
1111363338 13:87206871-87206893 CATCACGTGATAAAGGAAAAGGG + Intergenic
1111798735 13:92957034-92957056 AGTCACATTGAAAAGGAGAATGG - Intergenic
1112182926 13:97103170-97103192 CATCACATGATGAGAGAGAAAGG + Intergenic
1112875811 13:104037055-104037077 TATCACATGAGAAAGGAGAAAGG + Intergenic
1113182234 13:107642705-107642727 CGTTAGATGATAATGGGGAAAGG + Intronic
1113319420 13:109219532-109219554 TGTCACATGATAAAGGAGAAAGG + Intergenic
1114905112 14:27118417-27118439 TGTCACATGATAAAATAAAAAGG + Intergenic
1115059983 14:29176017-29176039 TGTCACATGATAAAAGAGAAAGG - Intergenic
1115130965 14:30051399-30051421 TGTCACATGATAAAGGAAAAAGG - Intronic
1116218785 14:42054659-42054681 TGTCTCATTATAAAGGAAAAAGG - Intergenic
1117056321 14:51915574-51915596 AGTCACTTTATAAAAGAGAACGG - Intronic
1117595987 14:57327744-57327766 TGTCACATGGTAAAGGAGAAAGG + Intergenic
1118374962 14:65168839-65168861 AGTCACATGATGAAGAAGAGGGG - Intergenic
1118609757 14:67531080-67531102 AGTGACCTGACAAAGGAGAATGG - Intronic
1118950482 14:70432439-70432461 TGTCACAAGATAAAGGAGAAAGG + Intergenic
1120350626 14:83353059-83353081 CATCACATTATAAAGGAAAAGGG - Intergenic
1120555745 14:85928513-85928535 TGTCACATGATAAAGGAGAAAGG + Intergenic
1120594413 14:86416298-86416320 TGTCACATGATAAATGAGAAAGG + Intergenic
1120974023 14:90233262-90233284 TGTCACATGATAAAGGAAAAAGG - Intergenic
1121012348 14:90527881-90527903 CATCACAAGCTAAAGGAAAATGG + Exonic
1121514651 14:94541609-94541631 AGTGAGGTGATAAAGGAGAAGGG - Intergenic
1122644489 14:103184529-103184551 CTTCTCCTGATAAAGGAGAATGG - Intergenic
1127270567 15:57397676-57397698 CGTCACATGTCAAAGGACACGGG - Intronic
1127357066 15:58210369-58210391 TGTCACGTGATAAAGGAGAAGGG - Intronic
1127602665 15:60553857-60553879 AGTGACAAGATAAAGGAAAATGG - Intronic
1128960355 15:71996933-71996955 TGTCACATGATAAAAATGAAAGG + Intronic
1129738744 15:77979736-77979758 CATCACATGAGACAAGAGAAGGG - Intergenic
1129767105 15:78177339-78177361 AGTCACTTCATAAAGGACAAAGG + Intronic
1129847213 15:78773444-78773466 CATCACATGAGACAAGAGAAGGG + Intronic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131137256 15:89947148-89947170 AGTCACATGACAAAGGAGATAGG + Intergenic
1136174106 16:28505875-28505897 TGTCCCCTGATAAAGGTGAAGGG + Intronic
1140382295 16:74500598-74500620 CCTCACTAGATAAAGGAAAAAGG + Intronic
1140796117 16:78439926-78439948 TGTCTCTTGATAAAGGAAAAAGG - Intronic
1141559245 16:84855898-84855920 TGTCCCATGATGAAGGAAAAAGG + Intronic
1143722832 17:8824894-8824916 AGTCAAATGATAAAGCAAAATGG + Intronic
1144617536 17:16790292-16790314 CGGCACATTATCAAGGAAAACGG + Intronic
1145137055 17:20418841-20418863 CGGCACATTATCAAGGAAAACGG + Intergenic
1146238312 17:31188358-31188380 AGTCATATGATAAAAGAAAAAGG - Intronic
1147013791 17:37473836-37473858 CCTCACATAATAAAAAAGAAGGG + Intronic
1148193931 17:45699886-45699908 CTTCACATGTTACAGGTGAAGGG - Intergenic
1149255159 17:54817577-54817599 TGTCACATGATAAAGGAGAAAGG - Intergenic
1149635267 17:58162202-58162224 CCTCACATGGCAAAGGAGCAAGG - Intergenic
1151037522 17:70819494-70819516 TGTCATATGATAAAGGAGAAAGG + Intergenic
1153130990 18:1855590-1855612 TGTCAAATGATAAAGAAGAAAGG + Intergenic
1154068743 18:11133185-11133207 TGTCACATGATAAAGGAGAAAGG - Intronic
1154252277 18:12754622-12754644 TGTCACATGATAAAGGAGAAAGG + Intergenic
1155416268 18:25602923-25602945 CTTGACATAATAAAGGAGGAAGG + Intergenic
1155432909 18:25780276-25780298 CGTCACATGGTCAAGCAGTAAGG + Intergenic
1156304125 18:35860824-35860846 TGTCACATGATAAAGGAAAAGGG - Intergenic
1156544836 18:37954254-37954276 TTTCACATGGTAAAGAAGAAAGG - Intergenic
1156582670 18:38395388-38395410 TGTCACATGATAAAGGAAAAAGG - Intergenic
1156606583 18:38673409-38673431 TGTCACATGATAAAGGAGAAAGG - Intergenic
1156990039 18:43398651-43398673 TGTCACATGATAAAAGAAAAAGG + Intergenic
1156995217 18:43457581-43457603 CATCACATGACAAGAGAGAATGG - Intergenic
1159151642 18:64530555-64530577 TGTCACATGATAAAGGAAAAAGG + Intergenic
1159288058 18:66377605-66377627 TGTCACATGATAAAGGAAAAAGG - Intergenic
1159711619 18:71766585-71766607 TGTCATATGATAAAGGAAAATGG - Intronic
1159736814 18:72109852-72109874 CTGCCCAAGATAAAGGAGAAGGG - Intergenic
1159850032 18:73516325-73516347 TGTTACATGATAAAGGGAAAAGG - Intergenic
1164053810 19:21605476-21605498 CGTCAAAAGAATAAGGAGAATGG + Intergenic
925089944 2:1146994-1147016 TGTCACATGATAAAGGAGAAAGG - Intronic
925461021 2:4062583-4062605 TGTCACATGATAAAGGAAAAAGG - Intergenic
925749588 2:7075612-7075634 CGTGTCATGACAAAGCAGAAAGG + Intergenic
927788743 2:25993155-25993177 GAACACATGATACAGGAGAAGGG - Intergenic
928129951 2:28642196-28642218 AATCACATCATAAAGGAGACTGG - Intronic
928988554 2:37205893-37205915 CGTATCATAATAAAGGAGCATGG + Intronic
929269540 2:39958675-39958697 TGCCACATGTTAAAGGAAAAAGG + Intergenic
930456372 2:51612434-51612456 TGTCACATAATAAAGGAGAAAGG + Intergenic
930772045 2:55138625-55138647 CAGCACATGATAAAAGTGAAGGG + Intergenic
930910467 2:56623324-56623346 TGTCACATGATAAAGGAAAAAGG - Intergenic
933052944 2:77622982-77623004 TGTCACATGATAAAGGAGAAAGG + Intergenic
933943258 2:87262842-87262864 CAGCACATGATGGAGGAGAAGGG + Intergenic
935008163 2:99102295-99102317 AGTCTCAAGATGAAGGAGAAGGG + Intronic
935547156 2:104412769-104412791 TGTCACATGCTAAAGGACAGAGG - Intergenic
936336956 2:111598719-111598741 CAGCACATGATGGAGGAGAAGGG - Intergenic
937581802 2:123496957-123496979 TGTGTCATGATAAAGGAGAAAGG + Intergenic
937802608 2:126097700-126097722 TGTCACATGATAAAGGAGAAAGG - Intergenic
939775311 2:146379690-146379712 TTTCACAAGATAAATGAGAATGG - Intergenic
940180396 2:150925332-150925354 AGGCAGAGGATAAAGGAGAAAGG - Intergenic
941330390 2:164172406-164172428 TGTCACATGATAAAGGAAAAAGG + Intergenic
941387067 2:164866708-164866730 TGTCCCATGACAAAGGAGAAAGG - Intergenic
941668312 2:168263225-168263247 TGTCACATGATAAAGGAGAAAGG - Intergenic
943317654 2:186410212-186410234 CGTCACATGATAAAGGAAAAAGG + Intergenic
943383794 2:187178956-187178978 TGTCACACGATAAAAGAGAAAGG + Intergenic
943517303 2:188905085-188905107 TGTCACATGATAAAGAAGAGAGG + Intergenic
943545022 2:189265432-189265454 CGTCACTTGATGATGGAGATTGG - Intergenic
943833335 2:192488993-192489015 TGTTACATGACAAAGGAAAAAGG + Intergenic
945717553 2:213378539-213378561 TATCACATGATAAGGGAAAAAGG + Intronic
945725568 2:213469351-213469373 TGTCACATGATAGAGGGGAAAGG + Intronic
946312561 2:218890886-218890908 GGACAGAGGATAAAGGAGAAAGG - Intronic
946703481 2:222435683-222435705 TGTCACATGATAAAGGAGAAAGG + Intronic
947085697 2:226449766-226449788 CGGCTCATGATGAAGGAAAAGGG - Intergenic
947350302 2:229236500-229236522 CCTGAAATGGTAAAGGAGAAAGG + Intronic
947373732 2:229474530-229474552 TGCCACCGGATAAAGGAGAAGGG + Intronic
948209352 2:236180952-236180974 GCTCACATGATAAAGGGGAGGGG - Intergenic
1168873985 20:1157540-1157562 TGTCACATGATAAAGGAGAAAGG + Intronic
1171308778 20:24128896-24128918 CTTCAAATGATAAAGGAAAGTGG - Intergenic
1173922917 20:46759310-46759332 GTTCACATGAGAAAGGGGAAAGG + Intergenic
1174338032 20:49877581-49877603 CGCCACATGACAAATGTGAAGGG - Intronic
1174739826 20:53001600-53001622 TGTCAGATGATAAATGAGACAGG - Intronic
1176998444 21:15582380-15582402 TGTCACAGGATAAAGGAAAAAGG - Intergenic
1177366646 21:20148312-20148334 CATCACGTGGTAAAGGGGAAAGG - Intergenic
1177832075 21:26150199-26150221 AGTCACAAGACAAAGGAGAGGGG + Intronic
1178062019 21:28862802-28862824 TGTCACATGATAAAGGAGAAAGG - Intergenic
1179414852 21:41190397-41190419 TGTCACATGCTAAAGGAAAAAGG + Intronic
1181367042 22:22385813-22385835 TGTTATATGATAAAGGAGAAAGG + Intergenic
1181373440 22:22437043-22437065 TGTCACATGATAAAGGAGAAAGG + Intergenic
1182965965 22:34521213-34521235 TGTCACATGACAAAGGAAAAAGG - Intergenic
1184603224 22:45555910-45555932 TGTCACTTGATAAAAGAGAAAGG + Intronic
1184921254 22:47607461-47607483 AGTCACATGGCAAAGGAAAAAGG - Intergenic
949125379 3:440954-440976 TGTCACATGATAAAGGAGAAAGG + Intergenic
949169743 3:984460-984482 TGTCACATGATAAAGGAAAAAGG + Intergenic
949246235 3:1927872-1927894 TGTCACATGAAAAAGGAGAAAGG + Intergenic
949445896 3:4133194-4133216 TGTCACATGATAAAGGAGAAAGG - Intronic
949681497 3:6519727-6519749 AGTCAAATGAGAAAGAAGAAAGG + Intergenic
949763218 3:7496006-7496028 CATCACTTGATAGAGGAAAAAGG - Intronic
951003844 3:17594622-17594644 TGTCATGTGATAAAGGAGAAAGG - Intronic
951052975 3:18115149-18115171 CGTCACAGGAAAGAGGAGGAGGG + Intronic
951970501 3:28439760-28439782 TGTCACATGATAAAGGAAAAAGG + Intronic
952618855 3:35311174-35311196 TGTAAAATGATAAAGGATAAAGG - Intergenic
954511210 3:51127555-51127577 TGTCACATGATAAAGGAGAAAGG + Intronic
955496052 3:59533797-59533819 GGTCACAGGATGGAGGAGAAGGG - Intergenic
955961114 3:64342154-64342176 CCTCAAATGATAAATGGGAATGG + Intronic
956360326 3:68440401-68440423 GGGCACATGATAAAGGAAAAAGG + Intronic
956509955 3:69982488-69982510 TGTCACATGATAGGGGAGAAAGG - Intergenic
957217702 3:77343029-77343051 CTTCACATGACAAAGGGGATAGG + Intronic
957689794 3:83553146-83553168 TGTCACATATTAAAGGAAAAAGG + Intergenic
957935299 3:86934812-86934834 CGTCACATGATAAAGGAAAAAGG + Intergenic
958036097 3:88172185-88172207 CCTCATATGACAAAAGAGAAAGG + Intergenic
958499664 3:94889022-94889044 TGTCACATAATAAAGGAAAAAGG - Intergenic
958660244 3:97057855-97057877 CTGCCCATGATAAAGGATAAGGG - Intronic
958667314 3:97158196-97158218 CTTTACATGATAAGGGAGTAGGG + Intronic
959226504 3:103595140-103595162 TGACACATGATAAAGGAGAAAGG + Intergenic
959377197 3:105601743-105601765 TGTCATATGATAAAGGAAAAAGG + Intergenic
959745743 3:109775148-109775170 TGTCACATAATAAAGGAAAAAGG + Intergenic
959998153 3:112700424-112700446 TGTCACATGATAAAGGAGAAAGG - Intergenic
960281446 3:115784928-115784950 GGTGACAGGATAATGGAGAAGGG + Intergenic
960494473 3:118358630-118358652 TGTCACATGATAACAGTGAAAGG + Intergenic
960794198 3:121467363-121467385 CCTGGCATGACAAAGGAGAAAGG + Intronic
962629703 3:137263755-137263777 AGTTACATGAGAAAGGAGAGAGG - Intergenic
963331532 3:143921268-143921290 TGTCACATGATAAAGGAAAAAGG + Intergenic
963453730 3:145517210-145517232 TGTCACATGATAAAGGAAAAAGG + Intergenic
964884563 3:161466385-161466407 CATCACATGACAAAAGAGGAAGG - Intergenic
965034727 3:163423786-163423808 TGTCACGTGAAAAAGGAGAAAGG + Intergenic
965374665 3:167908431-167908453 CGTCACAGGCTAAAGCAGGAAGG + Intergenic
965995939 3:174883536-174883558 TGTCACATGATAATGGAGAAAGG + Intronic
966044052 3:175528776-175528798 TGTCACATGATAAAGGAAAAAGG + Intronic
966311770 3:178602046-178602068 CTTGACATGATAGAGGAGAGAGG + Intronic
966445973 3:180000702-180000724 TGTCACGTGATAAGGGAAAAAGG - Intronic
966915624 3:184582764-184582786 GGTCACATGACCAAGGACAAAGG + Intronic
968618092 4:1591189-1591211 AGACACATTTTAAAGGAGAAAGG - Intergenic
968800526 4:2740557-2740579 TGTCACACGATAAAGGAGAAAGG - Intergenic
970805556 4:20026283-20026305 ACTCACATGATAATGGAGACTGG - Intergenic
971100736 4:23464248-23464270 TATCACATGATAAAGGAGAAAGG + Intergenic
971687111 4:29784953-29784975 TGTCACATGATATAGGAAAAAGG + Intergenic
971817496 4:31507199-31507221 TGTCGCATGATAAAGGAGAAAGG - Intergenic
971979026 4:33730736-33730758 GGTCACATGATAAAGCAAAAAGG + Intergenic
972192719 4:36613899-36613921 TGTCACATAATAAAGGAGAAAGG - Intergenic
972882702 4:43446035-43446057 TGTCACATGATAAAGAAAAAAGG + Intergenic
973692052 4:53445568-53445590 AGTGACAAGATAAAGGAAAAGGG + Intronic
974500196 4:62689547-62689569 TGTCACATGATAAAGGAAAAAGG + Intergenic
974644347 4:64672652-64672674 CGCCACATGATAAAGGAAAAAGG + Intergenic
975340441 4:73233736-73233758 CCTCACATGATAAAATAGAGGGG + Intronic
977431042 4:96930326-96930348 TGTCCCATGATAAAAGAGAAAGG - Intergenic
977701461 4:100027708-100027730 TGTCACATGATAAACGAAAAAGG + Intergenic
977832948 4:101615708-101615730 TGTCACATGATAAAGCAGAAAGG + Intronic
978272838 4:106912197-106912219 TGTAACATGATCAAGTAGAATGG + Intergenic
979075665 4:116266164-116266186 TGTCACATGATAAAGGAAAAAGG - Intergenic
979507288 4:121513163-121513185 TGTCATATTATAAAGGAAAAAGG + Intergenic
980203950 4:129693553-129693575 AGTCACAAAATAAAGCAGAAAGG - Intergenic
980629790 4:135416401-135416423 TGTCACATGGCAAAGGAGAAAGG - Intergenic
981391059 4:144192457-144192479 CAGAACATGATAAAGGAGACTGG - Intergenic
981873814 4:149517339-149517361 TGTCACATGATAAAGGGTAAAGG - Intergenic
982597503 4:157404928-157404950 TGTCACATGATAAAGGAAAAAGG + Intergenic
982623054 4:157730758-157730780 TGTCACATGATAAAGGAAAAGGG + Intergenic
983582975 4:169326984-169327006 TGTCACATGATAAAGGAGAAAGG - Intergenic
984868537 4:184306845-184306867 GGTCACATGGTAATGAAGAAGGG - Intergenic
985832603 5:2245469-2245491 TGTCACATGATAAAGGAAAAAGG - Intergenic
986036770 5:3948315-3948337 TGCCACATGATAAACGAGAAGGG + Intergenic
986396036 5:7331820-7331842 GGTCACAAGAAAAAGGAGGAAGG - Intergenic
986658918 5:10041722-10041744 GGTTACATGAGAAAGGGGAATGG - Intergenic
987025007 5:13918045-13918067 CAGCCCATGATCAAGGAGAAGGG - Intronic
987153466 5:15063790-15063812 GGTCACATGATAAAGGAGAAAGG - Intergenic
988168943 5:27630722-27630744 TTTCATATGATAAAGGAGAAAGG + Intergenic
988232744 5:28502013-28502035 CTTTACATGATAAAGAAAAAAGG + Intergenic
988267488 5:28971243-28971265 TGTCACATGATAAAGGAGAAAGG + Intergenic
988669196 5:33362731-33362753 CTTAACGTGATAAAGGAGCATGG - Intergenic
989457363 5:41659628-41659650 TATCACATGATAAAGGAGAAAGG + Intergenic
991330464 5:65487561-65487583 TGTCACATGATAAAGGAAAAAGG + Intergenic
991516770 5:67444857-67444879 CATCACAGGATAAAATAGAAGGG - Intergenic
992220261 5:74564809-74564831 AGTCACTGGAGAAAGGAGAATGG + Intergenic
992243239 5:74791991-74792013 TGTCACATGATAAAGGAAAAGGG - Intronic
993022651 5:82610342-82610364 TGTCACATGATAAAGGAAAAGGG - Intergenic
993231633 5:85245349-85245371 TGTCACATGATAAAGGAAAAAGG + Intergenic
993792059 5:92221038-92221060 TGTCACATGATAAAGGAAAAAGG - Intergenic
994291090 5:98029823-98029845 GGTTACCTGATAAAGGAAAAAGG + Intergenic
994604958 5:101955330-101955352 TGTCACATGATAAAGGAAAAAGG + Intergenic
994798471 5:104338194-104338216 CTTAACATGATTAAGGATAACGG - Intergenic
994917219 5:105995613-105995635 TATCACATGACAAAGGAAAAAGG - Intergenic
994958054 5:106560905-106560927 TGTCACATGATAAAGGAAAAAGG + Intergenic
995015075 5:107300823-107300845 CGCCACATGGTGAAGGAGATGGG + Intergenic
995082145 5:108064625-108064647 AGTCACATTATAAAGGAGTTTGG - Intronic
995279336 5:110315830-110315852 TGTCACATGATAAAGGAGAAAGG + Intronic
995775997 5:115725577-115725599 TGTTACATGATAAAGGAGAAAGG + Intergenic
996908677 5:128631830-128631852 TGTTACATGATAAAGGAAAAAGG + Intronic
997712475 5:136017411-136017433 AGTCAAATGATGAAAGAGAAAGG - Intergenic
998290050 5:140906421-140906443 TGTCACATGATAAACAAGAAAGG + Intronic
998639759 5:143996203-143996225 CCTCTCAGGATAAAGGAGAATGG - Intergenic
999659351 5:153842732-153842754 TGTCACATGGCAAGGGAGAAAGG - Intergenic
1000417293 5:160996335-160996357 TGTCACATGGTAAAGCAGAAAGG - Intergenic
1000499386 5:162030143-162030165 TGTCACATGATAAAGGAGAAAGG - Intergenic
1001685119 5:173588374-173588396 CATCAGAAGATAAAGGAGAACGG + Intergenic
1002998260 6:2306900-2306922 CATCACATGATAAAGGAGAAAGG - Intergenic
1006001827 6:30971199-30971221 CATCACATAATAAAGGAGAAAGG - Intergenic
1006741924 6:36315041-36315063 TGTCACCTGAGAGAGGAGAAAGG + Intergenic
1007875032 6:45088285-45088307 CATGACATGCTAAAGCAGAAGGG + Intronic
1009738574 6:67712825-67712847 CTTCAGATGATAAAGGATAAGGG - Intergenic
1009787053 6:68353847-68353869 TGTAACGTGATAAAGGAGAAAGG + Intergenic
1010107674 6:72188458-72188480 TGTCACATGATAAAGGAAAAAGG + Intronic
1010299015 6:74237085-74237107 AGTAAAATGAGAAAGGAGAATGG - Intergenic
1010323843 6:74542617-74542639 TGTCACATCATAAAGGAGAAAGG - Intergenic
1010368081 6:75076006-75076028 CGTCACATGATCATGAAAAAAGG + Intergenic
1010552439 6:77238993-77239015 CATCACATGAAAAAGGGAAAAGG - Intergenic
1010580537 6:77592118-77592140 TGTCACATGATAAAGGAAAAAGG + Intergenic
1010818907 6:80390536-80390558 TGTCACATGATAAAGGAAAAAGG - Intergenic
1011039074 6:83011173-83011195 TCTCACATGATAAAGGAAAAAGG + Intronic
1011069380 6:83363783-83363805 TGTCACATGATAAAGGAGGAAGG - Intronic
1012730707 6:102876409-102876431 GGTCACATGATAAAGAAAAAAGG - Intergenic
1012821061 6:104084902-104084924 TATCACGTGATAAAGAAGAAAGG - Intergenic
1013047692 6:106503705-106503727 CGACACATGATCAATCAGAAAGG - Intergenic
1013623710 6:111916812-111916834 TGTCACATGATAAAGGAAAAAGG + Intergenic
1014414976 6:121172763-121172785 CGTCACATGATAAAGGAGAAAGG - Intronic
1014521938 6:122454950-122454972 TGTCACATGATAAAGGAGAATGG - Intronic
1014533874 6:122594174-122594196 TGTTACATAATAAAGGAGAAAGG + Intronic
1014631912 6:123798936-123798958 TGTCACATGGGAAAGGAGAAAGG - Intergenic
1016147045 6:140690576-140690598 TGTCACATGATAAAGCAAAAAGG + Intergenic
1016575988 6:145570456-145570478 TGTCACATGATAAAGGAGAAAGG + Intronic
1018778193 6:167038128-167038150 CAACTCATGATAATGGAGAAAGG - Intronic
1020396943 7:7727270-7727292 TGTCTCATGATAAAGTAAAAAGG - Intronic
1020567494 7:9816717-9816739 TGTCACATGATAAAGGAAAAAGG + Intergenic
1020710598 7:11599507-11599529 TGTCACATGATAAAGGGAAAAGG - Intronic
1021989100 7:26125059-26125081 CGTCACATGGTAAAGAAAATAGG - Intergenic
1022079817 7:27008648-27008670 TGTCACATGACAAAGGGAAAAGG - Intergenic
1027406779 7:77870902-77870924 TATCACATGATAAAGGAGAAAGG + Intronic
1029588365 7:101490395-101490417 CGGCCCATGATAAAGCAGAGAGG + Intronic
1030355699 7:108539656-108539678 TGTCCCATGATAAAGGAGAAAGG - Intronic
1030559350 7:111065208-111065230 TGTCACATGATAAAGGAAAAAGG - Intronic
1030707271 7:112706675-112706697 CCTCACATGTTAAATAAGAATGG - Intergenic
1030931012 7:115523538-115523560 TGTCACATGATAAAGGAGAAAGG + Intergenic
1031440965 7:121794137-121794159 TGCCACATGATAAAGGAAAAAGG - Intergenic
1031833296 7:126652146-126652168 TGTCACATGTTAAAAGAAAAAGG - Intronic
1031861239 7:126982611-126982633 TGTCACATGATAAAGGAAAAAGG + Intronic
1031861425 7:126984044-126984066 TGTCACATGATAAAGGAAAAAGG - Intronic
1032630298 7:133643726-133643748 TGTCACATGATGAAGGAAAAAGG + Intronic
1033076541 7:138255150-138255172 TGTCACATGATAAAGGAAAAAGG - Intergenic
1034060519 7:148083040-148083062 AGTCACATTATAAAAGACAAGGG + Intronic
1037453667 8:19042146-19042168 CGTTACATAATAAAAGGGAAGGG + Intronic
1039330626 8:36533024-36533046 TGTCACATGAAAAAGGAGAAAGG - Intergenic
1041935584 8:63328131-63328153 TGTCACATGATAAAGGAAAATGG - Intergenic
1043105448 8:76104311-76104333 TGTCACATGATAAAGGAAAAAGG + Intergenic
1043116752 8:76265220-76265242 GCTCAAATGAGAAAGGAGAAAGG + Intergenic
1043258287 8:78162285-78162307 TGTCATATGATAAAGGAGAAAGG - Intergenic
1044632862 8:94296279-94296301 TATCACATGATAAAGGAAAAAGG + Intergenic
1045222058 8:100208692-100208714 TGTCACATGATAAAGGAAAAAGG - Intronic
1045321870 8:101087871-101087893 CGTCTCAGGAAAAAGGAGACAGG - Intergenic
1046197839 8:110886342-110886364 TGTCACATGATAAAGGAGAAAGG - Intergenic
1046585499 8:116145639-116145661 TGTCACATGATAAAGGAGAAAGG + Intergenic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1048167347 8:132075203-132075225 GGTGACATGAAAAAGGAGACGGG + Intronic
1048705234 8:137146432-137146454 CATCACATGATTAATGAGGAAGG + Intergenic
1049538804 8:143196264-143196286 TGTCACATGATAAAGGAAAAAGG - Intergenic
1050196152 9:3086522-3086544 TGTTACATGCTAAATGAGAAGGG - Intergenic
1050356317 9:4786303-4786325 CCTCACATGATCATGGAGGAAGG - Intergenic
1050482969 9:6104880-6104902 TGTCACATGATGAAGGAGAAAGG - Intergenic
1051482036 9:17571833-17571855 AGTCACCTGGGAAAGGAGAAGGG - Intergenic
1052368933 9:27642968-27642990 TGTCACATGATAAAGTAAACAGG - Intergenic
1052729701 9:32270966-32270988 CCACAGATGAGAAAGGAGAAGGG - Intergenic
1055585529 9:77755616-77755638 TGTCACATGATAAAGGAAAAAGG - Intronic
1056156958 9:83847335-83847357 TGTCACATGATAAAGGAAAAAGG - Intronic
1056313962 9:85370801-85370823 TGTCACATGATAAAGGAAAAAGG + Intergenic
1056353582 9:85776191-85776213 TGTCACATGATAAAGGAAAAAGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1057100317 9:92353127-92353149 TGTCACATGATAAAGGAAAAAGG + Intronic
1058258993 9:102807554-102807576 TGTCACATGATAAAGGAAAAAGG + Intergenic
1058625170 9:106927143-106927165 CCTCAAATGATAATTGAGAAAGG - Exonic
1059196226 9:112373758-112373780 TGTCACATGATAAAGGAAAAAGG + Intergenic
1059393946 9:114018623-114018645 TGTCAGATGGTAAAGCAGAAAGG + Intronic
1060010236 9:120037486-120037508 GGACAGAGGATAAAGGAGAAGGG - Intergenic
1061201899 9:129142849-129142871 GGCCACTTGATAAAGGAGAAGGG - Intronic
1203775832 EBV:72732-72754 CGTCACAAGATCAAAGAGATTGG - Intergenic
1186325218 X:8469157-8469179 CTTCTCAGGAAAAAGGAGAAAGG + Intergenic
1186519689 X:10194453-10194475 CCTCACATCATAAATGAGTAAGG - Intronic
1186857275 X:13638349-13638371 AGCCACATGACCAAGGAGAAGGG + Intergenic
1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG + Intergenic
1190119327 X:47647618-47647640 GGTCACATGAGGAAGAAGAAGGG - Intronic
1190155275 X:47986365-47986387 TGTCACATGATAAAGGAAAAAGG - Intronic
1190794283 X:53726446-53726468 CATCACATGATAAGAGAGGAGGG - Intergenic
1190996470 X:55615353-55615375 TGTCACATGAGAAAGGAAAAAGG + Intergenic
1191658527 X:63627670-63627692 TGTCACAGGATAAAAAAGAAAGG + Intergenic
1191769233 X:64737960-64737982 TGTCAGATGATAAAGGAGAAAGG + Intergenic
1192269002 X:69561004-69561026 CATCACATGATGAAGTAGAATGG + Intergenic
1192672984 X:73166274-73166296 CGTCACATGATAAAAGAGAAAGG + Intergenic
1192891200 X:75392708-75392730 TGTCACATGATAAAGGAGAAAGG + Intronic
1192898947 X:75473826-75473848 TGTCACATGATAAAGGAAAAAGG - Intronic
1193447434 X:81620894-81620916 TGTCACATGATAAAGGATAAAGG - Intergenic
1193904734 X:87227957-87227979 TGTCACATGATGAAGGAGAAAGG - Intergenic
1194174899 X:90632959-90632981 TGTCACATGATAAAGGAAAAAGG - Intergenic
1194343575 X:92733215-92733237 TGTCACATGATAAAATAAAAAGG - Intergenic
1194604098 X:95959684-95959706 AGTCACATGAAAAAGGAGAAAGG + Intergenic
1194834219 X:98660918-98660940 TGTCACCTGATATAAGAGAAAGG - Intergenic
1195748631 X:108143113-108143135 TGTCACATGATAAAGGAGAAAGG + Intronic
1195782015 X:108477440-108477462 CATCACATGATAAAGGAGAAAGG + Intronic
1196259159 X:113557635-113557657 GGTCAAATGACAAAAGAGAACGG - Intergenic
1196275902 X:113764801-113764823 TGTTACATGATAAAGGAAAAAGG - Intergenic
1197002567 X:121455069-121455091 CGTCACATGATACAGGAGAAAGG - Intergenic
1197074169 X:122335726-122335748 TGTCACATGCTAAGGGAGAAAGG + Intergenic
1197182381 X:123549906-123549928 TGTCACATGATAAAGGAGAAAGG - Intergenic
1197386518 X:125810130-125810152 AGTCACAAGATAGAGGAAAAAGG + Intergenic
1197420157 X:126228497-126228519 TGTCACATGTTAAAGTAGAAAGG - Intergenic
1198782773 X:140255676-140255698 TGTCACATGATAAAGGAAAAAGG + Intergenic
1199144189 X:144346825-144346847 TGTCACATGATAAAGGAGAAAGG + Intergenic
1199947630 X:152681061-152681083 CTCCACATCATAAAGAAGAAGGG + Intergenic
1199962049 X:152787393-152787415 CTCCACATCATAAAGAAGAAGGG - Intergenic
1200521550 Y:4214152-4214174 TGTCACATGATAAAGGAGAAAGG - Intergenic
1200651929 Y:5849880-5849902 TGTCACATGATAAAATAAAAAGG - Intergenic
1201385266 Y:13433751-13433773 CTTCACAAGATAGAAGAGAATGG + Intronic