ID: 1099491305

View in Genome Browser
Species Human (GRCh38)
Location 12:83292060-83292082
Sequence AGGGAGAGTGTAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099491296_1099491305 22 Left 1099491296 12:83292015-83292037 CCCCCTGGCAGTGGCTGTGCAGT No data
Right 1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG No data
1099491299_1099491305 19 Left 1099491299 12:83292018-83292040 CCTGGCAGTGGCTGTGCAGTACA No data
Right 1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG No data
1099491297_1099491305 21 Left 1099491297 12:83292016-83292038 CCCCTGGCAGTGGCTGTGCAGTA No data
Right 1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG No data
1099491298_1099491305 20 Left 1099491298 12:83292017-83292039 CCCTGGCAGTGGCTGTGCAGTAC No data
Right 1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG No data
1099491295_1099491305 25 Left 1099491295 12:83292012-83292034 CCACCCCCTGGCAGTGGCTGTGC No data
Right 1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099491305 Original CRISPR AGGGAGAGTGTAGTGATTGT GGG Intergenic
No off target data available for this crispr