ID: 1099495611

View in Genome Browser
Species Human (GRCh38)
Location 12:83342710-83342732
Sequence CAAAATGCTGATAGTGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099495607_1099495611 4 Left 1099495607 12:83342683-83342705 CCTAGAGACTGGTTGAATAGTTG No data
Right 1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099495611 Original CRISPR CAAAATGCTGATAGTGGTAT GGG Intergenic
No off target data available for this crispr