ID: 1099498287

View in Genome Browser
Species Human (GRCh38)
Location 12:83379202-83379224
Sequence CCTCACAAGTTCCCCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099498287_1099498291 12 Left 1099498287 12:83379202-83379224 CCAAGCCTGGGGAACTTGTGAGG No data
Right 1099498291 12:83379237-83379259 TTTTTAGTTAATTATATTTTGGG No data
1099498287_1099498292 13 Left 1099498287 12:83379202-83379224 CCAAGCCTGGGGAACTTGTGAGG No data
Right 1099498292 12:83379238-83379260 TTTTAGTTAATTATATTTTGGGG No data
1099498287_1099498290 11 Left 1099498287 12:83379202-83379224 CCAAGCCTGGGGAACTTGTGAGG No data
Right 1099498290 12:83379236-83379258 TTTTTTAGTTAATTATATTTTGG No data
1099498287_1099498293 14 Left 1099498287 12:83379202-83379224 CCAAGCCTGGGGAACTTGTGAGG No data
Right 1099498293 12:83379239-83379261 TTTAGTTAATTATATTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099498287 Original CRISPR CCTCACAAGTTCCCCAGGCT TGG (reversed) Intergenic
No off target data available for this crispr