ID: 1099506913

View in Genome Browser
Species Human (GRCh38)
Location 12:83489484-83489506
Sequence ATGTAATTCTTTAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099506913_1099506916 0 Left 1099506913 12:83489484-83489506 CCCTCTTCCTTAAAGAATTACAT No data
Right 1099506916 12:83489507-83489529 GACACAGTAACATCTTAATTTGG No data
1099506913_1099506919 29 Left 1099506913 12:83489484-83489506 CCCTCTTCCTTAAAGAATTACAT No data
Right 1099506919 12:83489536-83489558 ATAACAAAGTTTCATAGACTGGG No data
1099506913_1099506918 28 Left 1099506913 12:83489484-83489506 CCCTCTTCCTTAAAGAATTACAT No data
Right 1099506918 12:83489535-83489557 TATAACAAAGTTTCATAGACTGG No data
1099506913_1099506917 1 Left 1099506913 12:83489484-83489506 CCCTCTTCCTTAAAGAATTACAT No data
Right 1099506917 12:83489508-83489530 ACACAGTAACATCTTAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099506913 Original CRISPR ATGTAATTCTTTAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr