ID: 1099512687 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:83556526-83556548 |
| Sequence | GAGGGTGAGCTGAAGGAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3059 | |||
| Summary | {0: 3, 1: 166, 2: 451, 3: 822, 4: 1617} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1099512687_1099512698 | 19 | Left | 1099512687 | 12:83556526-83556548 | CCACCCTCCTTCAGCTCACCCTC | 0: 3 1: 166 2: 451 3: 822 4: 1617 |
||
| Right | 1099512698 | 12:83556568-83556590 | CAGTTCCAATGAGATGAACCAGG | 0: 17 1: 427 2: 918 3: 890 4: 1086 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1099512687 | Original CRISPR | GAGGGTGAGCTGAAGGAGGG TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||