ID: 1099512687

View in Genome Browser
Species Human (GRCh38)
Location 12:83556526-83556548
Sequence GAGGGTGAGCTGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3059
Summary {0: 3, 1: 166, 2: 451, 3: 822, 4: 1617}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099512687_1099512698 19 Left 1099512687 12:83556526-83556548 CCACCCTCCTTCAGCTCACCCTC 0: 3
1: 166
2: 451
3: 822
4: 1617
Right 1099512698 12:83556568-83556590 CAGTTCCAATGAGATGAACCAGG 0: 17
1: 427
2: 918
3: 890
4: 1086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099512687 Original CRISPR GAGGGTGAGCTGAAGGAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr