ID: 1099516545

View in Genome Browser
Species Human (GRCh38)
Location 12:83603488-83603510
Sequence GATTATTAACTGGGCAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099516540_1099516545 21 Left 1099516540 12:83603444-83603466 CCTTAAGAATCAATTGAAGATGC No data
Right 1099516545 12:83603488-83603510 GATTATTAACTGGGCAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099516545 Original CRISPR GATTATTAACTGGGCAAAAA TGG Intergenic
No off target data available for this crispr