ID: 1099516556

View in Genome Browser
Species Human (GRCh38)
Location 12:83603676-83603698
Sequence TGTTAATTACAGAAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099516553_1099516556 16 Left 1099516553 12:83603637-83603659 CCTAATTTGGACTTTTTGAACAA No data
Right 1099516556 12:83603676-83603698 TGTTAATTACAGAAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099516556 Original CRISPR TGTTAATTACAGAAGTTGGG TGG Intergenic
No off target data available for this crispr