ID: 1099525773

View in Genome Browser
Species Human (GRCh38)
Location 12:83718091-83718113
Sequence CATTGCAGGAAGGACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099525766_1099525773 4 Left 1099525766 12:83718064-83718086 CCCATTCAAATATCTTGAATTCC No data
Right 1099525773 12:83718091-83718113 CATTGCAGGAAGGACCTGGTGGG No data
1099525765_1099525773 5 Left 1099525765 12:83718063-83718085 CCCCATTCAAATATCTTGAATTC No data
Right 1099525773 12:83718091-83718113 CATTGCAGGAAGGACCTGGTGGG No data
1099525767_1099525773 3 Left 1099525767 12:83718065-83718087 CCATTCAAATATCTTGAATTCCT No data
Right 1099525773 12:83718091-83718113 CATTGCAGGAAGGACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099525773 Original CRISPR CATTGCAGGAAGGACCTGGT GGG Intergenic
No off target data available for this crispr