ID: 1099528085

View in Genome Browser
Species Human (GRCh38)
Location 12:83740826-83740848
Sequence GAGGGCAAACAGAAGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099528074_1099528085 26 Left 1099528074 12:83740777-83740799 CCTGGTTTATCTCACTGAGACTG No data
Right 1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099528085 Original CRISPR GAGGGCAAACAGAAGAGGGT GGG Intergenic
No off target data available for this crispr