ID: 1099541817

View in Genome Browser
Species Human (GRCh38)
Location 12:83919616-83919638
Sequence CTGCAGTATCAGATTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099541813_1099541817 -2 Left 1099541813 12:83919595-83919617 CCTTCTTACAGACCCCATTAACT No data
Right 1099541817 12:83919616-83919638 CTGCAGTATCAGATTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099541817 Original CRISPR CTGCAGTATCAGATTGATGA TGG Intergenic
No off target data available for this crispr